Rmu_sc0009879.1_g000002

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009879.1
Physical Location & Seq
Reverse (-)
14487 .. 15060
574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009879.1_g000002.1.cds

Sequence Viewer

Length: 489 bp
atgttttttcagtcagctattctgggaggtgaatcagcaagggcagtaaaaggtaactcccagattattgtaatgggccttgtttactgtgacatctgctccaacaacaccttctcccctcacagctacttcattccaggtgctgaggttaaaatagattgcgtattcaaagcagtgtcaccaagaattgcagaacacatatcattctcagcgaatagaactacaaacaggtatggggtgtacaagttggaaatcccatcagttgagggaatcaaatgtgcagaagattctgcgatagtttcttcctgccaggcgagcttaatgcggagtggatctccagcttgtaatgttcctggtttcaaatccacagcagatgaaatagcagtcaaatcaaaggaagctaatctctgcatctacagcctcaatgctttgaatttcagaccatcaaggagagacattgccttatgtggcaagaaaaaaattaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

17.52

Weight (kDa)

8.94

Isoelectric Point (pI)

37.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015014)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26960 AT5G41050
fragaria_vesca FvH4_6g53930
malus_domestica MD17G1011000.v1.1
prunus_persica Prupe.3G309900_v2.0.a1
pyrus_communis pycom17g00570
rosa_chinensis RchiOBHm_Chr2g0176091
rosa_laevigata RLG00000022380
rosa_multiflora Rmu_sc0009879.1_g000002
rosa_roxburghii Rroxscaffold_2G00076780
rosa_rugosa Rorug02G0590400
rosa_samantha Rh2AG669200 Rh2BG680800 Rh2CG643700 Rh2DG694500
rosa_wichuraiana Rw2G054890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 325
AclWI GGATC 1 cut(s) 340
AcsI RAATTY 1 cut(s) 433
AfaI GTAC 1 cut(s) 242
AgsI TTSAA 3 cut(s) 169, 361, 433
AjnI CCWGG 3 cut(s) 136, 309, 352
AjuI GAANNNNNNNTTGG 2 cut(s) 95, 127
AluBI AGCT 5 cut(s) 17, 126, 318, 341, 401
AluI AGCT 5 cut(s) 17, 126, 318, 341, 401
Alw26I GTCTC 1 cut(s) 447
AlwI GGATC 1 cut(s) 340
AlwNI CAGNNNCTG 1 cut(s) 143
AoxI GGCC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 433
AseI ATTAAT 1 cut(s) 483
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 2 cut(s) 41, 171
BbvCI CCTCAGC 1 cut(s) 144
BccI CCATC 2 cut(s) 265, 451
BcgI CGANNNNNNTGC 2 cut(s) 304, 338
BciT130I CCWGG 3 cut(s) 138, 311, 354
BcoDI GTCTC 1 cut(s) 447
BfmI CTRYAG 1 cut(s) 415
Bme1390I CCNGG 3 cut(s) 138, 311, 354
BmgT120I GGNCC 1 cut(s) 76
BmrFI CCNGG 3 cut(s) 138, 311, 354
BmsI GCATC 1 cut(s) 420
BplI GAGNNNNNCTC 2 cut(s) 319, 351
BpmI CTGGAG 1 cut(s) 321
Bpu10I CCTNAGC 1 cut(s) 144
BsaXI ACNNNNNCTCC 4 cut(s) 83, 98, 113, 128
Bse3DI GCAATG 1 cut(s) 456
BseBI CCWGG 3 cut(s) 138, 311, 354
BseMI GCAATG 1 cut(s) 456
BseMII CTCAG 2 cut(s) 135, 222
BsgI GTGCAG 1 cut(s) 300
BshFI GGCC 1 cut(s) 78
BsmAI GTCTC 1 cut(s) 447
BsnI GGCC 1 cut(s) 78
Bsp1407I TGTACA 1 cut(s) 240
Bsp143I GATC 1 cut(s) 332
BspACI CCGC 1 cut(s) 325
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 2 cut(s) 136, 221
BspPI GGATC 1 cut(s) 340
BsrDI GCAATG 1 cut(s) 456
BsrGI TGTACA 1 cut(s) 240
BssMI GATC 1 cut(s) 332
Bst2UI CCWGG 3 cut(s) 138, 311, 354
Bst4CI ACNGT 1 cut(s) 89
BstAUI TGTACA 1 cut(s) 240
BstC8I GCNNGC 1 cut(s) 316
BstDEI CTNAG 2 cut(s) 144, 208
BstKTI GATC 1 cut(s) 335
BstMAI GTCTC 1 cut(s) 447
BstMBI GATC 1 cut(s) 332
BstMWI GCNNNNNNNGC 2 cut(s) 315, 417
BstNI CCWGG 3 cut(s) 138, 311, 354
BstSCI CCNGG 3 cut(s) 136, 309, 352
BstSFI CTRYAG 1 cut(s) 415
BstX2I RGATCY 1 cut(s) 332
BstYI RGATCY 1 cut(s) 332
BsuRI GGCC 1 cut(s) 78
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 180
Cac8I GCNNGC 1 cut(s) 316
CaiI CAGNNNCTG 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 76
Csp6I GTAC 1 cut(s) 241
CviJI RGCY 7 cut(s) 17, 78, 126, 318, 341, 401, 420
CviKI_1 RGCY 7 cut(s) 17, 78, 126, 318, 341, 401, 420
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 2 cut(s) 144, 208
DpnI GATC 1 cut(s) 334
DpnII GATC 1 cut(s) 332
EcoRII CCWGG 3 cut(s) 136, 309, 352
FaiI YATR 3 cut(s) 200, 234, 466
GsuI CTGGAG 1 cut(s) 321
HaeIII GGCC 1 cut(s) 78
HinfI GANTC 3 cut(s) 32, 270, 287
HphI GGTGA 2 cut(s) 41, 171
Hpy166II GTNNAC 2 cut(s) 85, 241
Hpy188I TCNGA 1 cut(s) 440
Hpy8I GTNNAC 2 cut(s) 85, 241
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4V TGCA 3 cut(s) 191, 281, 411
HpyF10VI GCNNNNNNNGC 2 cut(s) 315, 417
HpyF3I CTNAG 2 cut(s) 144, 208
Kzo9I GATC 1 cut(s) 332
LmnI GCTCC 1 cut(s) 104
LweI GCATC 1 cut(s) 420
MaeIII GTNAC 3 cut(s) 53, 89, 177
MalI GATC 1 cut(s) 334
MboI GATC 1 cut(s) 332
MboII GAAGA 2 cut(s) 294, 296
MflI RGATCY 1 cut(s) 332
MluCI AATT 4 cut(s) 186, 433, 480, 484
MmeI TCCRAC 2 cut(s) 126, 228
MnlI CCTC 5 cut(s) 20, 129, 139, 259, 431
MseI TTAA 3 cut(s) 150, 320, 483
MspR9I CCNGG 3 cut(s) 138, 311, 354
MvaI CCWGG 3 cut(s) 138, 311, 354
MwoI GCNNNNNNNGC 2 cut(s) 315, 417
NdeII GATC 1 cut(s) 332
NmuCI GTSAC 2 cut(s) 89, 177
PfeI GAWTC 3 cut(s) 32, 270, 287
PshBI ATTAAT 1 cut(s) 483
Psp6I CCWGG 3 cut(s) 136, 309, 352
PspGI CCWGG 3 cut(s) 136, 309, 352
PspPI GGNCC 1 cut(s) 76
PstNI CAGNNNCTG 1 cut(s) 143
PsuI RGATCY 1 cut(s) 332
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 3 cut(s) 150, 320, 483
Sau3AI GATC 1 cut(s) 332
Sau96I GGNCC 1 cut(s) 76
ScrFI CCNGG 3 cut(s) 138, 311, 354
SfaNI GCATC 1 cut(s) 420
SfcI CTRYAG 1 cut(s) 415
Sse9I AATT 4 cut(s) 186, 433, 480, 484
SsiI CCGC 1 cut(s) 325
StyD4I CCNGG 3 cut(s) 136, 309, 352
TaaI ACNGT 1 cut(s) 89
TasI AATT 4 cut(s) 186, 433, 480, 484
TatI WGTACW 1 cut(s) 240
TfiI GAWTC 3 cut(s) 32, 270, 287
Tru1I TTAA 3 cut(s) 150, 320, 483
Tru9I TTAA 3 cut(s) 150, 320, 483
TscAI CASTG 1 cut(s) 180
TseFI GTSAC 2 cut(s) 89, 177
Tsp45I GTSAC 2 cut(s) 89, 177
TspDTI ATGAA 2 cut(s) 121, 390
TspRI CASTG 1 cut(s) 180
VspI ATTAAT 1 cut(s) 483
XapI RAATTY 1 cut(s) 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.