FvH4_7g28170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0007823
Physical Location & Seq
Forward (+)
20920180 .. 20920797
618 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g28170.t1

Sequence Viewer

Length: 429 bp
ATGATCGATACAACATTAGATTTGCTCATTCAGGCTACTTCCAATTCTCTGTTCATCTTCTGCTTCTGCAATTTGATCATAGCCATTATCCTCTTGGGCTCGAAATCCATCTCCGATGATCATGTAGAAAGCGCAATCCACATTAGAATGTCTACCAACAAGCATGATCAGGAAGATGAACAAGGGACAAGTGCTAAACAAGTTGGTGAGGAGAGGCAGGAGAGCAATGCCTTGATGCAGGTCAGTCAAGTATCAAAGGCCAACAATGCAGTTACTGAAGATTGTACAGTGAGCAAAACTAAATATGGTAATGGCAATGATGAAACTGAGGCCGGTGATGATGAGCTGAGGACAAGAGTAGAAGAATTTATACAAAAGGTTAATAAAGCATGGAATGCTGAATTTTTAAGAACCACATGCGTATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

15.85

Weight (kDa)

4.65

Isoelectric Point (pI)

38.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 229
AccI GTMKAC 1 cut(s) 152
AcsI RAATTY 2 cut(s) 365, 401
AcuI CTGAAG 1 cut(s) 297
AfaI GTAC 1 cut(s) 286
AjuI GAANNNNNNNTTGG 2 cut(s) 35, 67
AluBI AGCT 1 cut(s) 346
AluI AGCT 1 cut(s) 346
AlwNI CAGNNNCTG 1 cut(s) 275
AoxI GGCC 2 cut(s) 258, 330
ApoI RAATTY 2 cut(s) 365, 401
AspLEI GCGC 1 cut(s) 134
AsuHPI GGTGA 2 cut(s) 218, 347
BanII GRGCYC 1 cut(s) 101
BarI GAAGNNNNNNTAC 2 cut(s) 354, 386
BbvCI CCTCAGC 1 cut(s) 347
BccI CCATC 1 cut(s) 116
BclI TGATCA 3 cut(s) 75, 118, 166
BfaI CTAG 1 cut(s) 427
BfuAI ACCTGC 1 cut(s) 229
BmsI GCATC 1 cut(s) 225
Bpu10I CCTNAGC 1 cut(s) 347
Bsa29I ATCGAT 1 cut(s) 6
Bse118I RCCGGY 1 cut(s) 332
Bse3DI GCAATG 2 cut(s) 232, 322
BseCI ATCGAT 1 cut(s) 6
BseMI GCAATG 2 cut(s) 232, 322
BseMII CTCAG 2 cut(s) 318, 338
BseRI GAGGAG 1 cut(s) 224
BshFI GGCC 2 cut(s) 260, 332
BshVI ATCGAT 1 cut(s) 6
BsiSI CCGG 1 cut(s) 333
BslFI GGGAC 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 199
BsmI GAATGC 1 cut(s) 400
BsnI GGCC 2 cut(s) 260, 332
Bsp1286I GDGCHC 1 cut(s) 101
Bsp1407I TGTACA 1 cut(s) 284
Bsp143I GATC 4 cut(s) 3, 75, 118, 166
BspANI GGCC 2 cut(s) 260, 332
BspCNI CTCAG 2 cut(s) 319, 339
BspDI ATCGAT 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 229
BsrDI GCAATG 2 cut(s) 232, 322
BsrFI RCCGGY 1 cut(s) 332
BsrGI TGTACA 1 cut(s) 284
BssAI RCCGGY 1 cut(s) 332
BssMI GATC 4 cut(s) 3, 75, 118, 166
Bst4CI ACNGT 1 cut(s) 289
BstAPI GCANNNNNTGC 1 cut(s) 395
BstAUI TGTACA 1 cut(s) 284
BstDEI CTNAG 2 cut(s) 327, 347
BstHHI GCGC 1 cut(s) 134
BstKTI GATC 4 cut(s) 6, 78, 121, 169
BstMBI GATC 4 cut(s) 3, 75, 118, 166
BstMWI GCNNNNNNNGC 2 cut(s) 266, 395
BstNSI RCATGY 1 cut(s) 420
Bsu15I ATCGAT 1 cut(s) 6
BsuRI GGCC 2 cut(s) 260, 332
BsuTUI ATCGAT 1 cut(s) 6
BtsIMutI CAGTG 1 cut(s) 294
BveI ACCTGC 1 cut(s) 229
CaiI CAGNNNCTG 1 cut(s) 275
CfoI GCGC 1 cut(s) 134
Cfr10I RCCGGY 1 cut(s) 332
ClaI ATCGAT 1 cut(s) 6
Csp6I GTAC 1 cut(s) 285
CviAII CATG 4 cut(s) 122, 164, 390, 417
CviJI RGCY 6 cut(s) 35, 83, 99, 260, 332, 346
CviKI_1 RGCY 6 cut(s) 35, 83, 99, 260, 332, 346
CviQI GTAC 1 cut(s) 285
DdeI CTNAG 2 cut(s) 327, 347
DpnI GATC 4 cut(s) 5, 77, 120, 168
DpnII GATC 4 cut(s) 3, 75, 118, 166
Eco24I GRGCYC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 297
EcoT38I GRGCYC 1 cut(s) 101
FaeI CATG 4 cut(s) 125, 167, 393, 420
FaiI YATR 7 cut(s) 80, 123, 165, 306, 371, 391, 418
FaqI GGGAC 1 cut(s) 199
FatI CATG 4 cut(s) 121, 163, 389, 416
FbaI TGATCA 3 cut(s) 75, 118, 166
FblI GTMKAC 1 cut(s) 152
FriOI GRGCYC 1 cut(s) 101
FspBI CTAG 1 cut(s) 427
GlaI GCGC 1 cut(s) 133
HaeIII GGCC 2 cut(s) 260, 332
HapII CCGG 1 cut(s) 333
HhaI GCGC 1 cut(s) 134
Hin1II CATG 4 cut(s) 125, 167, 393, 420
Hin6I GCGC 1 cut(s) 132
HinP1I GCGC 1 cut(s) 132
HpaII CCGG 1 cut(s) 333
HphI GGTGA 2 cut(s) 218, 347
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 153
HpyCH4III ACNGT 1 cut(s) 289
HpyCH4V TGCA 3 cut(s) 69, 238, 269
HpyF10VI GCNNNNNNNGC 2 cut(s) 266, 395
HpyF3I CTNAG 2 cut(s) 327, 347
Hsp92II CATG 4 cut(s) 125, 167, 393, 420
HspAI GCGC 1 cut(s) 132
Ksp22I TGATCA 3 cut(s) 75, 118, 166
Kzo9I GATC 4 cut(s) 3, 75, 118, 166
LpnPI CCDG 5 cut(s) 17, 155, 203, 224, 346
LweI GCATC 1 cut(s) 225
MaeI CTAG 1 cut(s) 427
MaeIII GTNAC 1 cut(s) 271
MalI GATC 4 cut(s) 5, 77, 120, 168
MboI GATC 4 cut(s) 3, 75, 118, 166
MboII GAAGA 4 cut(s) 49, 185, 290, 374
MhlI GDGCHC 1 cut(s) 101
MluCI AATT 4 cut(s) 43, 70, 365, 401
MnlI CCTC 5 cut(s) 101, 202, 207, 322, 342
MseI TTAA 2 cut(s) 381, 407
MslI CAYNNNNRTG 1 cut(s) 146
MspI CCGG 1 cut(s) 333
Mva1269I GAATGC 1 cut(s) 400
MwoI GCNNNNNNNGC 2 cut(s) 266, 395
NdeII GATC 4 cut(s) 3, 75, 118, 166
NlaIII CATG 4 cut(s) 125, 167, 393, 420
NspI RCATGY 1 cut(s) 420
PctI GAATGC 1 cut(s) 400
PstNI CAGNNNCTG 1 cut(s) 275
RsaI GTAC 1 cut(s) 286
RsaNI GTAC 1 cut(s) 285
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 2 cut(s) 381, 407
Sau3AI GATC 4 cut(s) 3, 75, 118, 166
SduI GDGCHC 1 cut(s) 101
SetI ASST 3 cut(s) 243, 348, 381
SfaNI GCATC 1 cut(s) 225
SmiMI CAYNNNNRTG 1 cut(s) 146
Sse9I AATT 4 cut(s) 43, 70, 365, 401
SspMI CTAG 1 cut(s) 427
TaaI ACNGT 1 cut(s) 289
TaqI TCGA 2 cut(s) 6, 101
TasI AATT 4 cut(s) 43, 70, 365, 401
TatI WGTACW 1 cut(s) 284
Tru1I TTAA 2 cut(s) 381, 407
Tru9I TTAA 2 cut(s) 381, 407
TscAI CASTG 1 cut(s) 294
TspDTI ATGAA 3 cut(s) 43, 192, 336
TspRI CASTG 1 cut(s) 294
XapI RAATTY 2 cut(s) 365, 401
XceI RCATGY 1 cut(s) 420
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 152
XspI CTAG 1 cut(s) 427
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.