Rh1DG396100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
61377131 .. 61377556
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG396100.1

Sequence Viewer

Length: 426 bp
ATGCTTGATACAACATTAGATTTGCTCACTCAGGCAACTTCCAACTCTCTCATCATCTTCTGCTTCTGCAATTTGATCATAGCCATTATCCTCTTAGGCTCAAAATCCATCTCCGACGATCATGTAGAAAGCTCAATTCACCTCAGAAGGTCTACCAACAAGCATGAGGAAGATGAACAAGGTACAAGTGCTAAACAAGTTAGTGAGGAGAGGCTGGAGAGCAATGCCTCAATGCAAGTCAGTCAACCACCAAAGGCCAACCATGCAGTTCCTGATAATATTATAGTGAGCAAAATCATATATGGTAATGGCAATGATGAAACTGAGGCTGATGATGAGGAGCTGAGGACAAGAGTAGAAGAATTTATACAGAAGGTTAATCAAGCGTGGAAAGCTGAATTTTTAAGAACCACATGCATATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.85

Weight (kDa)

4.75

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 152
AcsI RAATTY 2 cut(s) 362, 398
AfaI GTAC 1 cut(s) 184
AluBI AGCT 3 cut(s) 132, 343, 395
AluI AGCT 3 cut(s) 132, 343, 395
AlwNI CAGNNNCTG 1 cut(s) 272
AoxI GGCC 1 cut(s) 255
ApoI RAATTY 2 cut(s) 362, 398
AsuHPI GGTGA 1 cut(s) 131
BarI GAAGNNNNNNTAC 2 cut(s) 351, 383
BbvCI CCTCAGC 1 cut(s) 344
BccI CCATC 1 cut(s) 116
BclI TGATCA 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 236
Bpu10I CCTNAGC 1 cut(s) 344
Bse3DI GCAATG 2 cut(s) 229, 319
BseMI GCAATG 2 cut(s) 229, 319
BseMII CTCAG 4 cut(s) 44, 157, 315, 335
BseRI GAGGAG 2 cut(s) 221, 353
BshFI GGCC 1 cut(s) 257
BsnI GGCC 1 cut(s) 257
Bsp143I GATC 2 cut(s) 75, 118
BspANI GGCC 1 cut(s) 257
BspCNI CTCAG 4 cut(s) 43, 156, 316, 336
BsrDI GCAATG 2 cut(s) 229, 319
BssMI GATC 2 cut(s) 75, 118
BstDEI CTNAG 5 cut(s) 30, 94, 143, 324, 344
BstKTI GATC 2 cut(s) 78, 121
BstMBI GATC 2 cut(s) 75, 118
BstMWI GCNNNNNNNGC 2 cut(s) 263, 392
BstNSI RCATGY 1 cut(s) 417
BsuRI GGCC 1 cut(s) 257
CaiI CAGNNNCTG 1 cut(s) 272
Csp6I GTAC 1 cut(s) 183
CviAII CATG 4 cut(s) 122, 164, 263, 414
CviJI RGCY 8 cut(s) 83, 99, 132, 214, 257, 329, 343, 395
CviKI_1 RGCY 8 cut(s) 83, 99, 132, 214, 257, 329, 343, 395
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 5 cut(s) 30, 94, 143, 324, 344
DpnI GATC 2 cut(s) 77, 120
DpnII GATC 2 cut(s) 75, 118
EcoT22I ATGCAT 1 cut(s) 419
FaeI CATG 4 cut(s) 125, 167, 266, 417
FatI CATG 4 cut(s) 121, 163, 262, 413
FbaI TGATCA 1 cut(s) 75
FblI GTMKAC 1 cut(s) 152
GsuI CTGGAG 1 cut(s) 236
HaeIII GGCC 1 cut(s) 257
Hin1II CATG 4 cut(s) 125, 167, 266, 417
HincII GTYRAC 1 cut(s) 245
HindII GTYRAC 1 cut(s) 245
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 153, 245
Hpy188I TCNGA 2 cut(s) 115, 146
Hpy188III TCNNGA 1 cut(s) 272
Hpy8I GTNNAC 2 cut(s) 153, 245
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 2 cut(s) 141, 367
HpyCH4V TGCA 4 cut(s) 69, 235, 266, 417
HpyF10VI GCNNNNNNNGC 2 cut(s) 263, 392
HpyF3I CTNAG 5 cut(s) 30, 94, 143, 324, 344
Hsp92II CATG 4 cut(s) 125, 167, 266, 417
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 2 cut(s) 75, 118
LmnI GCTCC 1 cut(s) 340
LpnPI CCDG 3 cut(s) 17, 200, 285
MalI GATC 2 cut(s) 77, 120
MboI GATC 2 cut(s) 75, 118
MboII GAAGA 3 cut(s) 49, 182, 371
MluCI AATT 4 cut(s) 70, 135, 362, 398
MmeI TCCRAC 2 cut(s) 66, 138
MnlI CCTC 9 cut(s) 101, 152, 160, 199, 204, 238, 319, 331, 339
Mph1103I ATGCAT 1 cut(s) 419
MseI TTAA 2 cut(s) 378, 404
MwoI GCNNNNNNNGC 2 cut(s) 263, 392
NdeII GATC 2 cut(s) 75, 118
NlaIII CATG 4 cut(s) 125, 167, 266, 417
NsiI ATGCAT 1 cut(s) 419
NspI RCATGY 1 cut(s) 417
PstNI CAGNNNCTG 1 cut(s) 272
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 2 cut(s) 378, 404
Sau3AI GATC 2 cut(s) 75, 118
SetI ASST 7 cut(s) 134, 144, 152, 184, 345, 378, 397
Sse9I AATT 4 cut(s) 70, 135, 362, 398
SspI AATATT 1 cut(s) 280
TasI AATT 4 cut(s) 70, 135, 362, 398
Tru1I TTAA 2 cut(s) 378, 404
Tru9I TTAA 2 cut(s) 378, 404
TspDTI ATGAA 2 cut(s) 189, 333
XapI RAATTY 2 cut(s) 362, 398
XceI RCATGY 1 cut(s) 417
XmiI GTMKAC 1 cut(s) 152
Zsp2I ATGCAT 1 cut(s) 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.