MD00G1028300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
4619530 .. 4619882
353 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1028300.v1.1.491

Sequence Viewer

Length: 174 bp
ATGCAGACCAAAAATGTTATGAGTGAAGAAAGTGAGAAGAGAATTATTACGGACTATAAAAGTGACGCTTCCCCAATCAAAGCTGGTCTTGCAGACGAAAACCCTAAGGAAGAACAAACAGATGCCTTTGTATCTCAGAGTGAGTGGAGGTATGGCCTTCTTGAATTACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.54

Weight (kDa)

4.49

Isoelectric Point (pI)

65.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 164
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AoxI GGCC 1 cut(s) 154
AxyI CCTNAGG 1 cut(s) 105
BmsI GCATC 1 cut(s) 112
Bse21I CCTNAGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 149
BshFI GGCC 1 cut(s) 156
BsnI GGCC 1 cut(s) 156
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 32
BstDEI CTNAG 2 cut(s) 105, 135
BstMWI GCNNNNNNNGC 1 cut(s) 89
Bsu36I CCTNAGG 1 cut(s) 105
BsuRI GGCC 1 cut(s) 156
CseI GACGC 1 cut(s) 74
CviJI RGCY 2 cut(s) 83, 156
CviKI_1 RGCY 2 cut(s) 83, 156
DdeI CTNAG 2 cut(s) 105, 135
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco81I CCTNAGG 1 cut(s) 105
FaiI YATR 3 cut(s) 20, 57, 153
FalI AAGNNNNNCTT 4 cut(s) 52, 84, 72, 104
HaeIII GGCC 1 cut(s) 156
HgaI GACGC 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 2 cut(s) 4, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 2 cut(s) 105, 135
LpnPI CCDG 1 cut(s) 69
LweI GCATC 1 cut(s) 112
MaeIII GTNAC 1 cut(s) 62
MboII GAAGA 3 cut(s) 38, 49, 122
MluCI AATT 2 cut(s) 42, 164
MnlI CCTC 1 cut(s) 141
MwoI GCNNNNNNNGC 1 cut(s) 89
NmuCI GTSAC 1 cut(s) 62
SetI ASST 2 cut(s) 85, 152
SfaNI GCATC 1 cut(s) 112
SgeI CNNG 2 cut(s) 96, 101
Sse9I AATT 2 cut(s) 42, 164
TasI AATT 2 cut(s) 42, 164
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspGWI ACGGA 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.