pycom02g05210

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
3450355 .. 3450654
300 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g05210.1

Sequence Viewer

Length: 300 bp
ATGCACCGAAAAATGGAAGCAGAAGAGATTCCAAGCAAAAGGTTTGACAAGGAAGAAAAAGCTAAAAAGTGGAAAGTGACAGCAGAGAAACCTGAAGAAAGAGAGGCCAAGATGAAAGAAAAGGCTTCGAGAAAGTTGAAAGCTTCTCATTCTGCAGATCTCAAACCACATAGAAAGGAGGCAATTGACAAGAAGGTTGATAAGATCCAAAAGGTGACTTCGGTTATTAGGAACTCACCAGAGAAAGATATAGCGAAATCTAAAAATGTGTCAAAGTGTCCAGAGGATCTCAGAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.54

Weight (kDa)

9.82

Isoelectric Point (pI)

49.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 199, 294
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 13
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 3 cut(s) 62, 143, 297
AluI AGCT 3 cut(s) 62, 143, 297
AlwI GGATC 2 cut(s) 199, 294
AoxI GGCC 1 cut(s) 105
Asp700I GAANNNNTTC 1 cut(s) 27
AsuHPI GGTGA 2 cut(s) 226, 228
BfmI CTRYAG 1 cut(s) 153
BglII AGATCT 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 13
BshFI GGCC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 13
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 3 cut(s) 157, 204, 286
BspANI GGCC 1 cut(s) 107
BspMAI CTGCAG 1 cut(s) 157
BspPI GGATC 2 cut(s) 199, 294
BssMI GATC 3 cut(s) 157, 204, 286
Bst6I CTCTTC 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 290
BstKTI GATC 3 cut(s) 160, 207, 289
BstMBI GATC 3 cut(s) 157, 204, 286
BstSFI CTRYAG 1 cut(s) 153
BstX2I RGATCY 3 cut(s) 157, 204, 286
BstYI RGATCY 3 cut(s) 157, 204, 286
BsuRI GGCC 1 cut(s) 107
CviJI RGCY 5 cut(s) 62, 107, 125, 143, 297
CviKI_1 RGCY 5 cut(s) 62, 107, 125, 143, 297
DdeI CTNAG 1 cut(s) 290
DpnI GATC 3 cut(s) 159, 206, 288
DpnII GATC 3 cut(s) 157, 204, 286
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 114
FaiI YATR 2 cut(s) 171, 251
HaeIII GGCC 1 cut(s) 107
HindIII AAGCTT 1 cut(s) 141
HinfI GANTC 1 cut(s) 28
HphI GGTGA 2 cut(s) 226, 228
Hpy188I TCNGA 1 cut(s) 293
Hpy188III TCNNGA 2 cut(s) 129, 281
HpyAV CCTTC 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 4, 155
HpyF3I CTNAG 1 cut(s) 290
Kzo9I GATC 3 cut(s) 157, 204, 286
LpnPI CCDG 3 cut(s) 105, 252, 294
MaeIII GTNAC 2 cut(s) 76, 214
MalI GATC 3 cut(s) 159, 206, 288
MboI GATC 3 cut(s) 157, 204, 286
MboII GAAGA 3 cut(s) 35, 65, 107
MfeI CAATTG 1 cut(s) 183
MflI RGATCY 3 cut(s) 157, 204, 286
MluCI AATT 1 cut(s) 183
MnlI CCTC 3 cut(s) 97, 172, 277
MroXI GAANNNNTTC 1 cut(s) 27
MunI CAATTG 1 cut(s) 183
NdeII GATC 3 cut(s) 157, 204, 286
NmuCI GTSAC 2 cut(s) 76, 214
PdmI GAANNNNTTC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 28
PstI CTGCAG 1 cut(s) 157
PsuI RGATCY 3 cut(s) 157, 204, 286
Sau3AI GATC 3 cut(s) 157, 204, 286
SetI ASST 7 cut(s) 44, 64, 94, 145, 198, 216, 299
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 8 cut(s) 45, 61, 104, 121, 141, 202, 251, 293
Sse9I AATT 1 cut(s) 183
TaqI TCGA 1 cut(s) 128
TasI AATT 1 cut(s) 183
TfiI GAWTC 1 cut(s) 28
TseFI GTSAC 2 cut(s) 76, 214
Tsp45I GTSAC 2 cut(s) 76, 214
TspDTI ATGAA 1 cut(s) 128
XmnI GAANNNNTTC 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.