pycom02g05190

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
3436094 .. 3436538
445 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g05190.1

Sequence Viewer

Length: 330 bp
ATGGGAATCGAAGAGTACCCCTCAAGACCTTTGCAGGCCGCTATGAAGAAACAGTTTGAGGAAGGTGAGAAGACTGTTTCAAGTCAATATCTCGGCAACCAATTACTGCAACAATCACAATCTCGAAACGCTCATCTCAGAAATGTAGCATGTAACTCAACTGAGCGGAAAAGAAATCACTTAAAGAAGGAAAATCCAGCCAAAAATCCTAAAGTAACTAAATCAGTTACCAAAATTGTGGTGAGTGAAGAAAGTGAGAAGAGAATTATTACGGAATATAAAAGTGACGCTTCCCCAATCAAAGCAGGTCTTGCAGGACGAAAACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.27

Weight (kDa)

9.85

Isoelectric Point (pI)

72.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 296
AccBSI CCGCTC 1 cut(s) 166
AciI CCGC 2 cut(s) 39, 166
AfaI GTAC 1 cut(s) 17
AgsI TTSAA 1 cut(s) 81
AoxI GGCC 1 cut(s) 36
AsuHPI GGTGA 2 cut(s) 77, 253
BbsI GAAGAC 1 cut(s) 77
BfuAI ACCTGC 1 cut(s) 296
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 77
BplI GAGNNNNNCTC 1 cut(s) 37
BpuEI CTTGAG 1 cut(s) 7
BseMII CTCAG 2 cut(s) 151, 153
BshFI GGCC 1 cut(s) 38
BsnI GGCC 1 cut(s) 38
BspACI CCGC 2 cut(s) 39, 166
BspANI GGCC 1 cut(s) 38
BspCNI CTCAG 2 cut(s) 150, 154
BspMI ACCTGC 1 cut(s) 296
BsrBI CCGCTC 1 cut(s) 166
Bst4CI ACNGT 2 cut(s) 54, 76
Bst6I CTCTTC 2 cut(s) 6, 254
BstAPI GCANNNNNTGC 1 cut(s) 311
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 137, 162
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstNSI RCATGY 1 cut(s) 153
BstV2I GAAGAC 1 cut(s) 77
BstXI CCANNNNNNTGG 1 cut(s) 238
BsuRI GGCC 1 cut(s) 38
BveI ACCTGC 1 cut(s) 296
Cac8I GCNNGC 1 cut(s) 36
CseI GACGC 1 cut(s) 296
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 150
CviJI RGCY 2 cut(s) 38, 200
CviKI_1 RGCY 2 cut(s) 38, 200
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 2 cut(s) 137, 162
Eam1104I CTCTTC 2 cut(s) 6, 254
EarI CTCTTC 2 cut(s) 6, 254
FaeI CATG 1 cut(s) 153
FaiI YATR 3 cut(s) 44, 151, 279
FalI AAGNNNNNCTT 4 cut(s) 274, 306, 294, 326
FatI CATG 1 cut(s) 149
Fnu4HI GCNGC 1 cut(s) 39
Fsp4HI GCNGC 1 cut(s) 39
GluI GCNGC 1 cut(s) 39
HaeIII GGCC 1 cut(s) 38
HgaI GACGC 1 cut(s) 296
Hin1II CATG 1 cut(s) 153
HinfI GANTC 1 cut(s) 6
HphI GGTGA 2 cut(s) 77, 253
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 2 cut(s) 24, 123
HpyAV CCTTC 2 cut(s) 56, 181
HpyCH4III ACNGT 2 cut(s) 54, 76
HpyCH4V TGCA 3 cut(s) 34, 109, 314
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 2 cut(s) 137, 162
Hsp92II CATG 1 cut(s) 153
LpnPI CCDG 4 cut(s) 20, 210, 291, 300
MaeIII GTNAC 4 cut(s) 152, 214, 226, 284
MbiI CCGCTC 1 cut(s) 166
MboII GAAGA 5 cut(s) 23, 58, 82, 260, 271
MluCI AATT 3 cut(s) 101, 234, 264
MnlI CCTC 2 cut(s) 31, 52
MseI TTAA 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 311
NlaIII CATG 1 cut(s) 153
NmeAIII GCCGAG 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 284
NspI RCATGY 1 cut(s) 153
PfeI GAWTC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 40
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SaqAI TTAA 1 cut(s) 182
SatI GCNGC 1 cut(s) 39
SetI ASST 3 cut(s) 31, 67, 310
SgeI CNNG 9 cut(s) 36, 47, 93, 104, 135, 162, 209, 318, 323
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 3 cut(s) 101, 234, 264
SsiI CCGC 2 cut(s) 39, 166
TaaI ACNGT 2 cut(s) 54, 76
TaqI TCGA 2 cut(s) 9, 124
TasI AATT 3 cut(s) 101, 234, 264
TauI GCSGC 1 cut(s) 41
TfiI GAWTC 1 cut(s) 6
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TseFI GTSAC 1 cut(s) 284
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 59
TspGWI ACGGA 1 cut(s) 287
XceI RCATGY 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.