Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0006380

Physical Location & Seq

Genomic Coordinates Reverse (-)

5171608 .. 5173895

Gene Structure 2288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1064100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 933 bp

ATGAAGCAGTCACATGGCAAGGACTATAGTGAAAGTTCAAAGGACAAGGCCAGCGAAGAACGCGGTTCTGATATTTTAGGGCGTAAGGGGAGTGCAGGGTGGTCAAAAGGTGGAGCTGTGTCTGCATCAGAAGATCCGAAACATGTAGGAGAAGTAAGTGTAAAGAAAGAAGATGGGAATGTTGAAGAGAAAAATGAAGAAGAATCTTTGCAGAATGTAAACGAAGCGAATCAGGTTGAAAAGGAAACAGAAATTCAGAACAAAGAATTGAACAATAAAGATGATAATTCTGAAGGTGCAGTTAAAGGAAATGATGAATCGGTGGGGCTCGACAAGAGTTCTTCGCATGAAGAAAATTACCAAGAGGGCCTAGGTACGCAGGCAGTTTTCGCTGATCAAGATGGTGCGAAACATGTGAATCATGATGAAGTAGGAGAGGACAAGGAGCAAATACCACAAGATAAGCACGACGAGCAAGAAAATGGAAAGGGACAAGCTAAGGAGCCAAAGAGATTGGAGGAATCTCGTACCACTGACAAGGAGCCAAAGAGTACAACATACAAGGACATTTCAGTACAACGCAGTGAAAGTAAGAATGACTCTCTTGAGGGCCAAAATTCAGTGGTAGACGGAGTGGTCCATGGCTTTGATGATGTGAATGGCGTGCCAGTAGATGGCCATGATCTCATAGAATCCATAGTGACTGGAACCGGCGGTGATCAAGCAATTACCGGACATCAGGAAATGAATTCGAGTTCTAACAATCAAAGTGAAATCAGCAAAAACGCATTAAATGAAGAAGTTGGGTCTAAAGAAGGAACAACTGGTGCTGATTTGGAAGCCAAAAGCAAAATCTCAGTACAAGGCTCGAACATTGACATTAAATCGAAGGTGGAAACAAGTTCAGACACCTCGAGGATCGATAGCGTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

311

Amino Acids

33.4

Weight (kDa)

4.61

Isoelectric Point (pI)

41.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006380)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g05950 FvH4_1g05950
malus_domestica	MD02G1064100.v1.1 MD15G1194600.v1.1
prunus_persica	Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1
pyrus_communis	pycom02g05020 pycom15g17430
rosa_chinensis	RchiOBHm_Chr2g0091571
rosa_laevigata	RLG00000016239
rosa_multiflora	Rmu_sc0000897.1_g000015
rosa_roxburghii	Rroxscaffold_2G00149860
rosa_rugosa	Rorug02G0018800.1 Rorug02G0018900.1 Rorug02G0019000 Rorug02G0019100
rosa_samantha	Rh2AG064200 Rh2BG063500 Rh2CG065200 Rh2DG063600
rosa_wichuraiana	Rw2G005620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	635
AbsI	CCTCGAGG	1 cut(s)	913
AccB7I	CCANNNNNTGG	1 cut(s)	674
AccI	GTMKAC	1 cut(s)	627
AccII	CGCG	1 cut(s)	63
AciI	CCGC	2 cut(s)	63, 714
AclWI	GGATC	2 cut(s)	128, 926
AcoI	YGGCCR	1 cut(s)	676
AcsI	RAATTY	3 cut(s)	252, 616, 748
AcuI	CTGAAG	1 cut(s)	312
AfaI	GTAC	5 cut(s)	376, 529, 553, 576, 861
AfiI	CCNNNNNNNGG	1 cut(s)	674
AflIII	ACRYGT	2 cut(s)	142, 412
AgsI	TTSAA	4 cut(s)	39, 185, 239, 271
AluBI	AGCT	2 cut(s)	116, 497
AluI	AGCT	2 cut(s)	116, 497
AlwI	GGATC	2 cut(s)	128, 926
Ama87I	CYCGRG	1 cut(s)	913
AoxI	GGCC	4 cut(s)	48, 367, 610, 676
ApoI	RAATTY	3 cut(s)	252, 616, 748
AspA2I	CCTAGG	1 cut(s)	370
AspS9I	GGNCC	3 cut(s)	367, 610, 637
AsuHPI	GGTGA	1 cut(s)	728
AvaI	CYCGRG	1 cut(s)	913
AvaII	GGWCC	1 cut(s)	637
AvrII	CCTAGG	1 cut(s)	370
BalI	TGGCCA	1 cut(s)	678
BanII	GRGCYC	1 cut(s)	330
BccI	CCATC	3 cut(s)	167, 395, 668
BclI	TGATCA	2 cut(s)	394, 718
BfaI	CTAG	1 cut(s)	371
BfmI	CTRYAG	1 cut(s)	25
BlnI	CCTAGG	1 cut(s)	370
Bme18I	GGWCC	1 cut(s)	637
BmeT110I	CYCGRG	1 cut(s)	913
BmgT120I	GGNCC	3 cut(s)	367, 610, 637
BmiI	GGNNCC	3 cut(s)	504, 543, 709
BmsI	GCATC	1 cut(s)	134
Bpu10I	CCTNAGC	1 cut(s)	498
BpuEI	CTTGAG	1 cut(s)	626
Bsa29I	ATCGAT	1 cut(s)	921
BsaJI	CCNNGG	2 cut(s)	370, 640
BsaWI	WCCGGW	1 cut(s)	731
Bsc4I	CCNNNNNNNGG	1 cut(s)	674
Bse118I	RCCGGY	1 cut(s)	710
Bse1I	ACTGG	3 cut(s)	668, 709, 829
BseCI	ATCGAT	1 cut(s)	921
BseDI	CCNNGG	2 cut(s)	370, 640
BseLI	CCNNNNNNNGG	1 cut(s)	674
BseMII	CTCAG	1 cut(s)	870
BseNI	ACTGG	3 cut(s)	668, 709, 829
BsgI	GTGCAG	2 cut(s)	114, 318
Bsh1236I	CGCG	1 cut(s)	63
BshFI	GGCC	4 cut(s)	50, 369, 612, 678
BshVI	ATCGAT	1 cut(s)	921
BsiHKCI	CYCGRG	1 cut(s)	913
BsiSI	CCGG	2 cut(s)	711, 732
BslFI	GGGAC	1 cut(s)	504
BslI	CCNNNNNNNGG	1 cut(s)	674
BsmFI	GGGAC	1 cut(s)	504
BsnI	GGCC	4 cut(s)	50, 369, 612, 678
BsoBI	CYCGRG	1 cut(s)	913
Bsp1286I	GDGCHC	1 cut(s)	330
Bsp143I	GATC	5 cut(s)	133, 394, 682, 718, 918
Bsp19I	CCATGG	1 cut(s)	640
BspACI	CCGC	2 cut(s)	63, 714
BspANI	GGCC	4 cut(s)	50, 369, 612, 678
BspCNI	CTCAG	1 cut(s)	869
BspDI	ATCGAT	1 cut(s)	921
BspFNI	CGCG	1 cut(s)	63
BspHI	TCATGA	1 cut(s)	421
BspLI	GGNNCC	3 cut(s)	504, 543, 709
BspPI	GGATC	2 cut(s)	128, 926
BsrFI	RCCGGY	1 cut(s)	710
BsrI	ACTGG	3 cut(s)	668, 709, 829
BssAI	RCCGGY	1 cut(s)	710
BssECI	CCNNGG	2 cut(s)	370, 640
BssMI	GATC	5 cut(s)	133, 394, 682, 718, 918
BssT1I	CCWWGG	2 cut(s)	370, 640
Bst6I	CTCTTC	1 cut(s)	180
BstC8I	GCNNGC	3 cut(s)	52, 381, 665
BstDEI	CTNAG	2 cut(s)	498, 856
BstDSI	CCRYGG	1 cut(s)	640
BstFNI	CGCG	1 cut(s)	63
BstKTI	GATC	5 cut(s)	136, 397, 685, 721, 921
BstMBI	GATC	5 cut(s)	133, 394, 682, 718, 918
BstMWI	GCNNNNNNNGC	4 cut(s)	60, 122, 389, 472
BstNSI	RCATGY	2 cut(s)	146, 416
BstSFI	CTRYAG	1 cut(s)	25
BstUI	CGCG	1 cut(s)	63
BstX2I	RGATCY	1 cut(s)	133
BstYI	RGATCY	1 cut(s)	133
Bsu15I	ATCGAT	1 cut(s)	921
BsuRI	GGCC	4 cut(s)	50, 369, 612, 678
BsuTUI	ATCGAT	1 cut(s)	921
BtgI	CCRYGG	1 cut(s)	640
BtsI	GCAGTG	1 cut(s)	589
BtsIMutI	CAGTG	3 cut(s)	531, 589, 627
Cac8I	GCNNGC	3 cut(s)	52, 381, 665
CciI	TCATGA	1 cut(s)	421
Cfr10I	RCCGGY	1 cut(s)	710
Cfr13I	GGNCC	3 cut(s)	367, 610, 637
ClaI	ATCGAT	1 cut(s)	921
Csp6I	GTAC	5 cut(s)	375, 528, 552, 575, 860
CviAII	CATG	7 cut(s)	14, 143, 347, 413, 422, 641, 680
CviQI	GTAC	5 cut(s)	375, 528, 552, 575, 860
DdeI	CTNAG	2 cut(s)	498, 856
DpnI	GATC	5 cut(s)	135, 396, 684, 720, 920
DpnII	GATC	5 cut(s)	133, 394, 682, 718, 918
DrdI	GACNNNNNNGTC	1 cut(s)	635
DseDI	GACNNNNNNGTC	1 cut(s)	635
EaeI	YGGCCR	1 cut(s)	676
Eam1104I	CTCTTC	1 cut(s)	180
EarI	CTCTTC	1 cut(s)	180
Eco130I	CCWWGG	2 cut(s)	370, 640
Eco24I	GRGCYC	1 cut(s)	330
Eco47I	GGWCC	1 cut(s)	637
Eco57I	CTGAAG	1 cut(s)	312
Eco88I	CYCGRG	1 cut(s)	913
EcoO109I	RGGNCCY	1 cut(s)	367
EcoRI	GAATTC	1 cut(s)	748
EcoT14I	CCWWGG	2 cut(s)	370, 640
EcoT38I	GRGCYC	1 cut(s)	330
ErhI	CCWWGG	2 cut(s)	370, 640
FaeI	CATG	7 cut(s)	17, 146, 350, 416, 425, 644, 683
FaqI	GGGAC	1 cut(s)	504
FatI	CATG	7 cut(s)	13, 142, 346, 412, 421, 640, 679
FbaI	TGATCA	2 cut(s)	394, 718
FblI	GTMKAC	1 cut(s)	627
FriOI	GRGCYC	1 cut(s)	330
FspBI	CTAG	1 cut(s)	371
HaeIII	GGCC	4 cut(s)	50, 369, 612, 678
HapII	CCGG	2 cut(s)	711, 732
Hin1II	CATG	7 cut(s)	17, 146, 350, 416, 425, 644, 683
HinfI	GANTC	7 cut(s)	203, 229, 317, 418, 521, 599, 692
HpaII	CCGG	2 cut(s)	711, 732
HphI	GGTGA	1 cut(s)	728
Hpy166II	GTNNAC	2 cut(s)	220, 628
Hpy188I	TCNGA	6 cut(s)	70, 130, 138, 258, 292, 907
Hpy188III	TCNNGA	4 cut(s)	398, 422, 605, 740
Hpy8I	GTNNAC	2 cut(s)	220, 628
Hpy99I	CGWCG	1 cut(s)	473
HpyAV	CCTTC	3 cut(s)	287, 809, 883
HpyCH4V	TGCA	4 cut(s)	95, 125, 211, 299
HpyF10VI	GCNNNNNNNGC	4 cut(s)	60, 122, 389, 472
HpyF3I	CTNAG	2 cut(s)	498, 856
Hsp92II	CATG	7 cut(s)	17, 146, 350, 416, 425, 644, 683
Ksp22I	TGATCA	2 cut(s)	394, 718
Kzo9I	GATC	5 cut(s)	133, 394, 682, 718, 918
LmnI	GCTCC	4 cut(s)	113, 445, 502, 541
LweI	GCATC	1 cut(s)	134
MaeI	CTAG	1 cut(s)	371
MaeIII	GTNAC	2 cut(s)	9, 700
MalI	GATC	5 cut(s)	135, 396, 684, 720, 920
MboI	GATC	5 cut(s)	133, 394, 682, 718, 918
MboII	GAAGA	9 cut(s)	68, 143, 182, 197, 209, 212, 333, 362, 809
MflI	RGATCY	1 cut(s)	133
MhlI	GDGCHC	1 cut(s)	330
MlsI	TGGCCA	1 cut(s)	678
MluCI	AATT	7 cut(s)	252, 266, 286, 355, 616, 726, 748
MluNI	TGGCCA	1 cut(s)	678
MlyI	GAGTC	1 cut(s)	593
MnlI	CCTC	6 cut(s)	358, 430, 511, 601, 909, 922
Mox20I	TGGCCA	1 cut(s)	678
MscI	TGGCCA	1 cut(s)	678
MseI	TTAA	4 cut(s)	303, 791, 882, 931
Msp20I	TGGCCA	1 cut(s)	678
MspI	CCGG	2 cut(s)	711, 732
MvnI	CGCG	1 cut(s)	63
MwoI	GCNNNNNNNGC	4 cut(s)	60, 122, 389, 472
NcoI	CCATGG	1 cut(s)	640
NdeII	GATC	5 cut(s)	133, 394, 682, 718, 918
NlaIII	CATG	7 cut(s)	17, 146, 350, 416, 425, 644, 683
NlaIV	GGNNCC	3 cut(s)	504, 543, 709
NmuCI	GTSAC	2 cut(s)	9, 700
NspI	RCATGY	2 cut(s)	146, 416
PaeR7I	CTCGAG	1 cut(s)	913
PagI	TCATGA	1 cut(s)	421
PciI	ACATGT	2 cut(s)	142, 412
PfeI	GAWTC	6 cut(s)	203, 229, 317, 418, 521, 692
PflMI	CCANNNNNTGG	1 cut(s)	674
PleI	GAGTC	1 cut(s)	593
PpsI	GAGTC	1 cut(s)	593
PscI	ACATGT	2 cut(s)	142, 412
PspN4I	GGNNCC	3 cut(s)	504, 543, 709
PspPI	GGNCC	3 cut(s)	367, 610, 637
PspXI	VCTCGAGB	1 cut(s)	913
PsuI	RGATCY	1 cut(s)	133
RsaI	GTAC	5 cut(s)	376, 529, 553, 576, 861
RsaNI	GTAC	5 cut(s)	375, 528, 552, 575, 860
SaqAI	TTAA	4 cut(s)	303, 791, 882, 931
Sau3AI	GATC	5 cut(s)	133, 394, 682, 718, 918
Sau96I	GGNCC	3 cut(s)	367, 610, 637
SchI	GAGTC	1 cut(s)	593
SduI	GDGCHC	1 cut(s)	330
SetI	ASST	8 cut(s)	112, 118, 237, 298, 376, 499, 894, 914
SfaNI	GCATC	1 cut(s)	134
SfcI	CTRYAG	1 cut(s)	25
Sfr274I	CTCGAG	1 cut(s)	913
SinI	GGWCC	1 cut(s)	637
SlaI	CTCGAG	1 cut(s)	913
SmlI	CTYRAG	2 cut(s)	605, 913
SmoI	CTYRAG	2 cut(s)	605, 913
Sse9I	AATT	7 cut(s)	252, 266, 286, 355, 616, 726, 748
SsiI	CCGC	2 cut(s)	63, 714
SspMI	CTAG	1 cut(s)	371
StyI	CCWWGG	2 cut(s)	370, 640
TaqI	TCGA	6 cut(s)	330, 752, 869, 887, 914, 921
TasI	AATT	7 cut(s)	252, 266, 286, 355, 616, 726, 748
TatI	WGTACW	3 cut(s)	551, 574, 859
TfiI	GAWTC	6 cut(s)	203, 229, 317, 418, 521, 692
Tru1I	TTAA	4 cut(s)	303, 791, 882, 931
Tru9I	TTAA	4 cut(s)	303, 791, 882, 931
TscAI	CASTG	3 cut(s)	538, 589, 627
TseFI	GTSAC	2 cut(s)	9, 700
Tsp45I	GTSAC	2 cut(s)	9, 700
TspDTI	ATGAA	7 cut(s)	17, 210, 330, 363, 441, 761, 810
TspGWI	ACGGA	1 cut(s)	645
TspRI	CASTG	3 cut(s)	538, 589, 627
Van91I	CCANNNNNTGG	1 cut(s)	674
VpaK11BI	GGWCC	1 cut(s)	637
XapI	RAATTY	3 cut(s)	252, 616, 748
XceI	RCATGY	2 cut(s)	146, 416
XhoI	CTCGAG	1 cut(s)	913
XmaJI	CCTAGG	1 cut(s)	370
XmiI	GTMKAC	1 cut(s)	627
XspI	CTAG	1 cut(s)	371

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.