Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000897.1

Orthogroup ID

OG0006380

Physical Location & Seq

Genomic Coordinates Forward (+)

122809 .. 123789

Gene Structure 981 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000897.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 981 bp

atgaattctcagtctaatggccgcagccagagacccaaagggaagagggtaaagctggccattcagattgtgtcggttttggctgtttgcttgtggttgttataccaagcaaagcagtctcgtgataaggactacagtggaagtgtacagaacgaggttattgaaaaacatggttctggtattttggggcgtaaagcgaatgcaggtggttcaattcttgtgggagaaagcctaaacgatgaagatcgggctggtggagttgatgtattggatggaaatgttgaagagaagcacaaagtaaatgatgatggagatcttgggagacctgaagggaaagaaagtgaaaacaaagtggaattgatatacaaagaactgaacaatactgatgataattctgatattgaactcaaagctaatagtgaggcagtgggactggacgagaattcattgcaagaaggaaactcccaagtagggtatgaagataaacaggtgacaatgtctgatcaggacggtgagaaagatgtgaagaatactagtcaccatgaagttggagaggatgaggagcaaatatctcatgttaatcgtgttgagcaaggacatgaaagggatacacagaaagagtcggagacaaaggacctcagttctgacaacgagtttctagttcagcctaccgaaaggaagaatgattctcttcaggatcacaattcaatggtaaatggtgtccgtggctttgatgatgagaatggtgttcctgtggatggtaacgatatcatagaatcaagagtgactggatcaagtggtgatggtgaaattagttcacatgaagaaatgtattcaacttcaaacagtcaaagtgaaaacagtgaaagcactcaaagtgaagaagttgttgttagaggagataatgctgattttgaagccagaagcaaaatctcggtacaagattcaggttctaaggcagaaacaaactctgaagtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

326

Amino Acids

35.69

Weight (kDa)

4.48

Isoelectric Point (pI)

48.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006380)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g05950 FvH4_1g05950
malus_domestica	MD02G1064100.v1.1 MD15G1194600.v1.1
prunus_persica	Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1 Prupe.7G221600_v2.0.a1
pyrus_communis	pycom02g05020 pycom15g17430
rosa_chinensis	RchiOBHm_Chr2g0091571
rosa_laevigata	RLG00000016239
rosa_multiflora	Rmu_sc0000897.1_g000015
rosa_roxburghii	Rroxscaffold_2G00149860
rosa_rugosa	Rorug02G0018800.1 Rorug02G0018900.1 Rorug02G0019000 Rorug02G0019100
rosa_samantha	Rh2AG064200 Rh2BG063500 Rh2CG065200 Rh2DG063600
rosa_wichuraiana	Rw2G005620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	194
Acc36I	ACCTGC	1 cut(s)	194
AciI	CCGC	1 cut(s)	22
AclWI	GGATC	2 cut(s)	705, 799
AcoI	YGGCCR	2 cut(s)	19, 57
AcsI	RAATTY	2 cut(s)	4, 442
AcuI	CTGAAG	2 cut(s)	348, 677
AfaI	GTAC	2 cut(s)	147, 939
AfiI	CCNNNNNNNGG	2 cut(s)	471, 758
AgsI	TTSAA	8 cut(s)	164, 213, 284, 404, 708, 837, 843, 917
AhlI	ACTAGT	1 cut(s)	533
AluBI	AGCT	2 cut(s)	55, 413
AluI	AGCT	2 cut(s)	55, 413
Alw26I	GTCTC	4 cut(s)	25, 123, 316, 620
AlwI	GGATC	2 cut(s)	705, 799
AoxI	GGCC	2 cut(s)	19, 57
ApeKI	GCWGC	1 cut(s)	24
ApoI	RAATTY	2 cut(s)	4, 442
AspS9I	GGNCC	1 cut(s)	634
AsuHPI	GGTGA	5 cut(s)	502, 524, 530, 812, 818
AvaII	GGWCC	1 cut(s)	634
BalI	TGGCCA	1 cut(s)	59
BauI	CACGAG	1 cut(s)	120
BbvI	GCAGC	1 cut(s)	36
BccI	CCATC	4 cut(s)	266, 302, 752, 797
BciVI	GTATCC	1 cut(s)	601
BclI	TGATCA	1 cut(s)	502
BcoDI	GTCTC	4 cut(s)	25, 123, 316, 620
BcuI	ACTAGT	1 cut(s)	533
BfaI	CTAG	2 cut(s)	534, 659
BfmI	CTRYAG	1 cut(s)	133
BfuAI	ACCTGC	1 cut(s)	194
BfuI	GTATCC	1 cut(s)	601
BglII	AGATCT	1 cut(s)	313
BisI	GCNGC	2 cut(s)	22, 25
BlsI	GCNGC	2 cut(s)	23, 26
Bme18I	GGWCC	1 cut(s)	634
BmgT120I	GGNCC	1 cut(s)	634
BsaBI	GATNNNNATC	2 cut(s)	243, 312
BsaI	GGTCTC	2 cut(s)	25, 316
BsaJI	CCNNGG	1 cut(s)	724
BsaXI	ACNNNNNCTCC	2 cut(s)	249, 279
Bsc4I	CCNNNNNNNGG	2 cut(s)	471, 758
Bse1I	ACTGG	2 cut(s)	438, 793
Bse3DI	GCAATG	1 cut(s)	446
Bse8I	GATNNNNATC	2 cut(s)	243, 312
BseDI	CCNNGG	1 cut(s)	724
BseGI	GGATG	3 cut(s)	277, 562, 763
BseJI	GATNNNNATC	2 cut(s)	243, 312
BseLI	CCNNNNNNNGG	2 cut(s)	471, 758
BseMI	GCAATG	1 cut(s)	446
BseMII	CTCAG	2 cut(s)	23, 652
BseNI	ACTGG	2 cut(s)	438, 793
BseRI	GAGGAG	2 cut(s)	575, 912
BseXI	GCAGC	1 cut(s)	36
BshFI	GGCC	2 cut(s)	21, 59
BslFI	GGGAC	1 cut(s)	444
BslI	CCNNNNNNNGG	2 cut(s)	471, 758
BsmAI	GTCTC	4 cut(s)	25, 123, 316, 620
BsmFI	GGGAC	1 cut(s)	444
BsmI	GAATGC	1 cut(s)	205
BsnI	GGCC	2 cut(s)	21, 59
Bso31I	GGTCTC	2 cut(s)	25, 316
Bsp1407I	TGTACA	1 cut(s)	145
Bsp143I	GATC	5 cut(s)	244, 313, 502, 697, 791
BspACI	CCGC	1 cut(s)	22
BspANI	GGCC	2 cut(s)	21, 59
BspCNI	CTCAG	2 cut(s)	22, 651
BspMI	ACCTGC	1 cut(s)	194
BspPI	GGATC	2 cut(s)	705, 799
BspTNI	GGTCTC	2 cut(s)	25, 316
BsrDI	GCAATG	1 cut(s)	446
BsrGI	TGTACA	1 cut(s)	145
BsrI	ACTGG	2 cut(s)	438, 793
BssECI	CCNNGG	1 cut(s)	724
BssMI	GATC	5 cut(s)	244, 313, 502, 697, 791
BssSI	CACGAG	1 cut(s)	120
Bst2BI	CACGAG	1 cut(s)	120
Bst4CI	ACNGT	4 cut(s)	137, 512, 848, 863
Bst6I	CTCTTC	3 cut(s)	38, 279, 696
BstAUI	TGTACA	1 cut(s)	145
BstC8I	GCNNGC	1 cut(s)	57
BstDEI	CTNAG	3 cut(s)	9, 638, 954
BstDSI	CCRYGG	1 cut(s)	724
BstF5I	GGATG	3 cut(s)	277, 562, 763
BstKTI	GATC	5 cut(s)	247, 316, 505, 700, 794
BstMAI	GTCTC	4 cut(s)	25, 123, 316, 620
BstMBI	GATC	5 cut(s)	244, 313, 502, 697, 791
BstSFI	CTRYAG	1 cut(s)	133
BstV1I	GCAGC	1 cut(s)	36
BstX2I	RGATCY	1 cut(s)	313
BstXI	CCANNNNNNTGG	1 cut(s)	548
BstYI	RGATCY	1 cut(s)	313
BsuI	GTATCC	1 cut(s)	601
BsuRI	GGCC	2 cut(s)	21, 59
BtgI	CCRYGG	1 cut(s)	724
BtsCI	GGATG	3 cut(s)	277, 562, 763
BtsI	GCAGTG	1 cut(s)	432
BtsIMutI	CAGTG	3 cut(s)	142, 432, 868
BveI	ACCTGC	1 cut(s)	194
Cac8I	GCNNGC	1 cut(s)	57
Cfr13I	GGNCC	1 cut(s)	634
Csp6I	GTAC	2 cut(s)	146, 938
CspCI	CAANNNNNGTGG	2 cut(s)	201, 236
CviAII	CATG	5 cut(s)	170, 542, 575, 599, 821
CviQI	GTAC	2 cut(s)	146, 938
DdeI	CTNAG	3 cut(s)	9, 638, 954
DpnI	GATC	5 cut(s)	246, 315, 504, 699, 793
DpnII	GATC	5 cut(s)	244, 313, 502, 697, 791
EaeI	YGGCCR	2 cut(s)	19, 57
Eam1104I	CTCTTC	3 cut(s)	38, 279, 696
EarI	CTCTTC	3 cut(s)	38, 279, 696
Eco31I	GGTCTC	2 cut(s)	25, 316
Eco32I	GATATC	1 cut(s)	769
Eco47I	GGWCC	1 cut(s)	634
Eco57I	CTGAAG	2 cut(s)	348, 677
EcoO109I	RGGNCCY	1 cut(s)	634
EcoRI	GAATTC	2 cut(s)	4, 442
EcoRV	GATATC	1 cut(s)	769
FaeI	CATG	5 cut(s)	173, 545, 578, 602, 824
FaiI	YATR	9 cut(s)	103, 171, 364, 477, 543, 576, 600, 773, 822
FaqI	GGGAC	1 cut(s)	444
FatI	CATG	5 cut(s)	169, 541, 574, 598, 820
FbaI	TGATCA	1 cut(s)	502
Fnu4HI	GCNGC	2 cut(s)	22, 25
FokI	GGATG	3 cut(s)	284, 569, 770
Fsp4HI	GCNGC	2 cut(s)	22, 25
FspBI	CTAG	2 cut(s)	534, 659
GluI	GCNGC	2 cut(s)	22, 25
HaeIII	GGCC	2 cut(s)	21, 59
Hin1II	CATG	5 cut(s)	173, 545, 578, 602, 824
HinfI	GANTC	4 cut(s)	620, 686, 776, 944
HphI	GGTGA	5 cut(s)	502, 524, 530, 812, 818
Hpy166II	GTNNAC	2 cut(s)	146, 818
Hpy188I	TCNGA	7 cut(s)	66, 397, 502, 625, 646, 973, 980
Hpy188III	TCNNGA	4 cut(s)	122, 506, 695, 780
Hpy8I	GTNNAC	2 cut(s)	146, 818
HpyAV	CCTTC	2 cut(s)	323, 449
HpyCH4III	ACNGT	4 cut(s)	137, 512, 848, 863
HpyCH4V	TGCA	2 cut(s)	203, 451
HpyF3I	CTNAG	3 cut(s)	9, 638, 954
Hsp92II	CATG	5 cut(s)	173, 545, 578, 602, 824
Ksp22I	TGATCA	1 cut(s)	502
Kzo9I	GATC	5 cut(s)	244, 313, 502, 697, 791
LmnI	GCTCC	1 cut(s)	562
Lsp1109I	GCAGC	1 cut(s)	36
MaeI	CTAG	2 cut(s)	534, 659
MaeIII	GTNAC	4 cut(s)	490, 536, 761, 784
MalI	GATC	5 cut(s)	246, 315, 504, 699, 793
MboI	GATC	5 cut(s)	244, 313, 502, 697, 791
MboII	GAAGA	9 cut(s)	55, 254, 296, 491, 538, 683, 691, 836, 893
MflI	RGATCY	1 cut(s)	313
MlsI	TGGCCA	1 cut(s)	59
MluCI	AATT	7 cut(s)	4, 213, 356, 391, 442, 703, 810
MluNI	TGGCCA	1 cut(s)	59
MlyI	GAGTC	1 cut(s)	629
MmeI	TCCRAC	2 cut(s)	529, 603
MnlI	CCTC	7 cut(s)	39, 148, 415, 547, 553, 647, 890
Mox20I	TGGCCA	1 cut(s)	59
MscI	TGGCCA	1 cut(s)	59
MseI	TTAA	1 cut(s)	579
Msp20I	TGGCCA	1 cut(s)	59
Mva1269I	GAATGC	1 cut(s)	205
NdeII	GATC	5 cut(s)	244, 313, 502, 697, 791
NlaIII	CATG	5 cut(s)	173, 545, 578, 602, 824
NmuCI	GTSAC	3 cut(s)	490, 536, 784
PaqCI	CACCTGC	1 cut(s)	194
PctI	GAATGC	1 cut(s)	205
PfeI	GAWTC	3 cut(s)	686, 776, 944
PflFI	GACNNNGTC	1 cut(s)	496
PkrI	GCNGC	2 cut(s)	23, 26
PleI	GAGTC	1 cut(s)	628
PpsI	GAGTC	1 cut(s)	628
PpuMI	RGGWCCY	1 cut(s)	634
Psp5II	RGGWCCY	1 cut(s)	634
PspPI	GGNCC	1 cut(s)	634
PspPPI	RGGWCCY	1 cut(s)	634
PsuI	RGATCY	1 cut(s)	313
PsyI	GACNNNGTC	1 cut(s)	496
RsaI	GTAC	2 cut(s)	147, 939
RsaNI	GTAC	2 cut(s)	146, 938
SaqAI	TTAA	1 cut(s)	579
SatI	GCNGC	2 cut(s)	22, 25
Sau3AI	GATC	5 cut(s)	244, 313, 502, 697, 791
Sau96I	GGNCC	1 cut(s)	634
SchI	GAGTC	1 cut(s)	629
SetI	ASST	8 cut(s)	57, 159, 208, 328, 415, 492, 639, 952
SfcI	CTRYAG	1 cut(s)	133
SinI	GGWCC	1 cut(s)	634
SpeI	ACTAGT	1 cut(s)	533
Sse9I	AATT	7 cut(s)	4, 213, 356, 391, 442, 703, 810
SsiI	CCGC	1 cut(s)	22
SspMI	CTAG	2 cut(s)	534, 659
TaaI	ACNGT	4 cut(s)	137, 512, 848, 863
TasI	AATT	7 cut(s)	4, 213, 356, 391, 442, 703, 810
TatI	WGTACW	1 cut(s)	145
TauI	GCSGC	1 cut(s)	24
TfiI	GAWTC	3 cut(s)	686, 776, 944
Tru1I	TTAA	1 cut(s)	579
Tru9I	TTAA	1 cut(s)	579
TscAI	CASTG	3 cut(s)	142, 432, 868
TseFI	GTSAC	3 cut(s)	490, 536, 784
TseI	GCWGC	1 cut(s)	24
Tsp45I	GTSAC	3 cut(s)	490, 536, 784
TspDTI	ATGAA	7 cut(s)	17, 255, 435, 492, 558, 615, 837
TspGWI	ACGGA	1 cut(s)	713
TspRI	CASTG	3 cut(s)	142, 432, 868
Tth111I	GACNNNGTC	1 cut(s)	496
VpaK11BI	GGWCC	1 cut(s)	634
XapI	RAATTY	2 cut(s)	4, 442
XspI	CTAG	2 cut(s)	534, 659

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.