MD03G1266000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0013341
Physical Location & Seq
Forward (+)
35123781 .. 35126447
2667 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1266000.v1.1.491

Sequence Viewer

Length: 525 bp
ATGTTGTGGCTGCCGTCACAAGTTTTGGATGAAGCAATATGTAACACAAAGGCAAATTCGAGGCTCCATGCAAAACACCATCACCACCACCACAATGATCATTTGGTGAATTCAAAATCTAGCTCAATGAGACCACATCATGGACCAAAAGTCCATGTGAATTGGTCATCCGGAGGACCTGGAATGCAAGCCATTTTCCTGGATTCTAGCCAAAAATCATGTGGCACGGGCGTTTTTCTTCCACAACGAGCAGGCACCCACTTCCACAGAACTAAAAAACCAGCTTGTGCTCCCGTTCTGCTGCCCTCTCGTGTGGTTCAAGCTCTGAACCTCAACGTGCATGCACTAGGCCTGCAAGTTTCACCTCGACAAGATTTTAAAGATCACAAGCGAAAAAGTGAAAACTACTTGGCAGCTCAAAACAAGAATGAGAATAAGGATGTTTCGTCTACTCAATACTACATTATTTCCCAAAGTCCGAATTCTTCACCAGAGTTGTTTCTTCCAAAGGAATGGACTTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

175

Amino Acids

19.58

Weight (kDa)

9.68

Isoelectric Point (pI)

56.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013341)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02830 AT4G02830 AT4G02830
fragaria_vesca FvH4_2g23650
malus_domestica MD03G1266000.v1.1 MD11G1286400.v1.1
prunus_persica Prupe.8G241700_v2.0.a1
pyrus_communis pycom03g21250 pycom11g25390
rosa_chinensis RchiOBHm_Chr6g0291121
rosa_laevigata RLG00000012142
rosa_roxburghii Rroxscaffold_7G00176360
rosa_rugosa Rorug06G0217800
rosa_samantha Rh6AG328000 Rh6BG335500 Rh6CG341700 Rh6DG328900
rosa_wichuraiana Rw6G028530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 254
AccB7I CCANNNNNTGG 1 cut(s) 140
AccI GTMKAC 1 cut(s) 449
AccIII TCCGGA 1 cut(s) 170
AcsI RAATTY 3 cut(s) 55, 109, 481
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 2 cut(s) 114, 320
AhdI GACNNNNNGTC 1 cut(s) 149
AjnI CCWGG 2 cut(s) 178, 198
AluBI AGCT 4 cut(s) 123, 284, 323, 416
AluI AGCT 4 cut(s) 123, 284, 323, 416
Alw21I GWGCWC 1 cut(s) 292
Alw26I GTCTC 1 cut(s) 124
Aor13HI TCCGGA 1 cut(s) 170
AoxI GGCC 1 cut(s) 349
ApeKI GCWGC 3 cut(s) 10, 301, 413
ApoI RAATTY 3 cut(s) 55, 109, 481
AspS9I GGNCC 2 cut(s) 143, 176
AsuHPI GGTGA 4 cut(s) 74, 118, 354, 480
AvaII GGWCC 2 cut(s) 143, 176
BanI GGYRCC 1 cut(s) 254
BauI CACGAG 1 cut(s) 309
Bbv12I GWGCWC 1 cut(s) 292
BbvI GCAGC 2 cut(s) 288, 425
BccI CCATC 1 cut(s) 87
BciT130I CCWGG 2 cut(s) 180, 200
BclI TGATCA 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 124
BfaI CTAG 3 cut(s) 120, 207, 347
BisI GCNGC 3 cut(s) 11, 302, 414
BlsI GCNGC 3 cut(s) 12, 303, 415
Bme1390I CCNGG 2 cut(s) 180, 200
Bme18I GGWCC 2 cut(s) 143, 176
BmeRI GACNNNNNGTC 1 cut(s) 149
BmgT120I GGNCC 2 cut(s) 143, 176
BmiI GGNNCC 2 cut(s) 65, 256
BmrFI CCNGG 2 cut(s) 180, 200
BsaI GGTCTC 1 cut(s) 124
BsaWI WCCGGW 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 140
BseAI TCCGGA 1 cut(s) 170
BseBI CCWGG 2 cut(s) 180, 200
BseGI GGATG 3 cut(s) 34, 167, 445
BseLI CCNNNNNNNGG 1 cut(s) 140
BseXI GCAGC 2 cut(s) 288, 425
BshFI GGCC 1 cut(s) 351
BshNI GGYRCC 1 cut(s) 254
BsiHKAI GWGCWC 1 cut(s) 292
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 124
BsmI GAATGC 1 cut(s) 189
BsnI GGCC 1 cut(s) 351
Bso31I GGTCTC 1 cut(s) 124
Bsp1286I GDGCHC 1 cut(s) 292
Bsp13I TCCGGA 1 cut(s) 170
Bsp143I GATC 2 cut(s) 97, 382
BspANI GGCC 1 cut(s) 351
BspEI TCCGGA 1 cut(s) 170
BspLI GGNNCC 2 cut(s) 65, 256
BspT107I GGYRCC 1 cut(s) 254
BspTNI GGTCTC 1 cut(s) 124
BssMI GATC 2 cut(s) 97, 382
BssSI CACGAG 1 cut(s) 309
Bst2BI CACGAG 1 cut(s) 309
Bst2UI CCWGG 2 cut(s) 180, 200
BstC8I GCNNGC 4 cut(s) 189, 253, 342, 353
BstF5I GGATG 3 cut(s) 34, 167, 445
BstKTI GATC 2 cut(s) 100, 385
BstMAI GTCTC 1 cut(s) 124
BstMBI GATC 2 cut(s) 97, 382
BstNI CCWGG 2 cut(s) 180, 200
BstNSI RCATGY 1 cut(s) 344
BstSCI CCNGG 2 cut(s) 178, 198
BstV1I GCAGC 2 cut(s) 288, 425
BstXI CCANNNNNNTGG 2 cut(s) 199, 513
BsuRI GGCC 1 cut(s) 351
BtsCI GGATG 3 cut(s) 34, 167, 445
Cac8I GCNNGC 4 cut(s) 189, 253, 342, 353
Cfr13I GGNCC 2 cut(s) 143, 176
CviAII CATG 5 cut(s) 68, 140, 155, 219, 341
CviJI RGCY 9 cut(s) 10, 64, 123, 191, 210, 284, 323, 351, 416
CviKI_1 RGCY 9 cut(s) 10, 64, 123, 191, 210, 284, 323, 351, 416
DpnI GATC 2 cut(s) 99, 384
DpnII GATC 2 cut(s) 97, 382
DraI TTTAAA 1 cut(s) 379
DriI GACNNNNNGTC 1 cut(s) 149
Eam1105I GACNNNNNGTC 1 cut(s) 149
Eco147I AGGCCT 1 cut(s) 351
Eco31I GGTCTC 1 cut(s) 124
Eco47I GGWCC 2 cut(s) 143, 176
EcoO109I RGGNCCY 1 cut(s) 176
EcoRI GAATTC 2 cut(s) 109, 481
EcoRII CCWGG 2 cut(s) 178, 198
FaeI CATG 5 cut(s) 71, 143, 158, 222, 344
FaiI YATR 6 cut(s) 40, 69, 141, 156, 220, 342
FatI CATG 5 cut(s) 67, 139, 154, 218, 340
FbaI TGATCA 1 cut(s) 97
FblI GTMKAC 1 cut(s) 449
Fnu4HI GCNGC 3 cut(s) 11, 302, 414
FokI GGATG 3 cut(s) 41, 154, 452
Fsp4HI GCNGC 3 cut(s) 11, 302, 414
FspBI CTAG 3 cut(s) 120, 207, 347
GluI GCNGC 3 cut(s) 11, 302, 414
HaeIII GGCC 1 cut(s) 351
HapII CCGG 1 cut(s) 171
Hin1II CATG 5 cut(s) 71, 143, 158, 222, 344
HinfI GANTC 1 cut(s) 203
HpaII CCGG 1 cut(s) 171
HphI GGTGA 4 cut(s) 74, 118, 354, 480
Hpy166II GTNNAC 1 cut(s) 450
Hpy188I TCNGA 2 cut(s) 327, 480
Hpy188III TCNNGA 1 cut(s) 171
Hpy8I GTNNAC 1 cut(s) 450
HpyCH4IV ACGT 1 cut(s) 336
HpyCH4V TGCA 5 cut(s) 71, 187, 340, 344, 355
HpySE526I ACGT 1 cut(s) 336
Hsp92II CATG 5 cut(s) 71, 143, 158, 222, 344
Kpn2I TCCGGA 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 2 cut(s) 97, 382
LmnI GCTCC 2 cut(s) 69, 295
LpnPI CCDG 9 cut(s) 165, 184, 185, 192, 212, 237, 294, 365, 504
Lsp1109I GCAGC 2 cut(s) 288, 425
MaeI CTAG 3 cut(s) 120, 207, 347
MaeII ACGT 1 cut(s) 336
MaeIII GTNAC 2 cut(s) 15, 41
MalI GATC 2 cut(s) 99, 384
MboI GATC 2 cut(s) 97, 382
MboII GAAGA 3 cut(s) 230, 477, 494
MhlI GDGCHC 1 cut(s) 292
MluCI AATT 4 cut(s) 55, 109, 160, 481
MnlI CCTC 5 cut(s) 54, 167, 316, 341, 375
MroI TCCGGA 1 cut(s) 170
MseI TTAA 1 cut(s) 378
MslI CAYNNNNRTG 1 cut(s) 93
MspI CCGG 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 180, 200
Mva1269I GAATGC 1 cut(s) 189
MvaI CCWGG 2 cut(s) 180, 200
NdeII GATC 2 cut(s) 97, 382
NlaIII CATG 5 cut(s) 71, 143, 158, 222, 344
NlaIV GGNNCC 2 cut(s) 65, 256
NmuCI GTSAC 1 cut(s) 15
NspI RCATGY 1 cut(s) 344
PaeI GCATGC 1 cut(s) 344
PceI AGGCCT 1 cut(s) 351
PctI GAATGC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 203
PflMI CCANNNNNTGG 1 cut(s) 140
PfoI TCCNGGA 1 cut(s) 198
PkrI GCNGC 3 cut(s) 12, 303, 415
PpuMI RGGWCCY 1 cut(s) 176
Psp5II RGGWCCY 1 cut(s) 176
Psp6I CCWGG 2 cut(s) 178, 198
PspGI CCWGG 2 cut(s) 178, 198
PspN4I GGNNCC 2 cut(s) 65, 256
PspPI GGNCC 2 cut(s) 143, 176
PspPPI RGGWCCY 1 cut(s) 176
RseI CAYNNNNRTG 1 cut(s) 93
SaqAI TTAA 1 cut(s) 378
SatI GCNGC 3 cut(s) 11, 302, 414
Sau3AI GATC 2 cut(s) 97, 382
Sau96I GGNCC 2 cut(s) 143, 176
ScrFI CCNGG 2 cut(s) 180, 200
SduI GDGCHC 1 cut(s) 292
SetI ASST 8 cut(s) 125, 181, 286, 325, 333, 339, 367, 418
SinI GGWCC 2 cut(s) 143, 176
SmiMI CAYNNNNRTG 1 cut(s) 93
SphI GCATGC 1 cut(s) 344
Sse9I AATT 4 cut(s) 55, 109, 160, 481
SseBI AGGCCT 1 cut(s) 351
SspMI CTAG 3 cut(s) 120, 207, 347
StuI AGGCCT 1 cut(s) 351
StyD4I CCNGG 2 cut(s) 178, 198
TaiI ACGT 1 cut(s) 339
TaqI TCGA 2 cut(s) 59, 367
TasI AATT 4 cut(s) 55, 109, 160, 481
TfiI GAWTC 1 cut(s) 203
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TseFI GTSAC 1 cut(s) 15
TseI GCWGC 3 cut(s) 10, 301, 413
Tsp45I GTSAC 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 45
Van91I CCANNNNNTGG 1 cut(s) 140
VpaK11BI GGWCC 2 cut(s) 143, 176
XapI RAATTY 3 cut(s) 55, 109, 481
XceI RCATGY 1 cut(s) 344
XcmI CCANNNNNNNNNTGG 1 cut(s) 218
XmiI GTMKAC 1 cut(s) 449
XspI CTAG 3 cut(s) 120, 207, 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.