pycom03g21250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0013341
Physical Location & Seq
Forward (+)
21568608 .. 21571387
2780 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g21250.1

Sequence Viewer

Length: 564 bp
ATGGCTGCTCATGAAGAAGAAGAGATTTGTTTTGAAGAAGGAATGTTGTGGCTGCCGTCACAAGTTTTGGATGAAGCAATATGTGACACAAAGGCAAATTCGAGGCTCCATGCAAAACACCATCACCACCACCACAATGATCATTTGAATTCAAAATCTAGCACAATGAGACCACATCATAGACCAAAAATCCATGTGAATTGGTCATCCGGAGGACCTGGAATGCAAGCCATTTTCCTGGATTCTAGCCAAAAATCATGTGGCACGGGCGTTTTTCTTCCACAACGAGCAGGCACCCACTTCCACAGAACCAAAAAACCAGCTTGTGCTCCCGTTCTGCTGCCCTCTCGTGTGGTTCAAGCTCTGAACCTCAACGTCCATGCACTAGGCCTGCAAGTTTCACCTCGACAAGATTTTAAAGATCACAAGCGAAAAAGTGAAGACTACTTGGCAACTCAAAACAAGAACGGGAATAAGGATGTTTCGTCTACCCAATACTACATTATTTCCCAAAATCCGAATTCTTCACCAGAATTGTTTCTTCCAAAGGAATGGACTTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

188

Amino Acids

21.2

Weight (kDa)

8.67

Isoelectric Point (pI)

57.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013341)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02830 AT4G02830 AT4G02830
fragaria_vesca FvH4_2g23650
malus_domestica MD03G1266000.v1.1 MD11G1286400.v1.1
prunus_persica Prupe.8G241700_v2.0.a1
pyrus_communis pycom03g21250 pycom11g25390
rosa_chinensis RchiOBHm_Chr6g0291121
rosa_laevigata RLG00000012142
rosa_roxburghii Rroxscaffold_7G00176360
rosa_rugosa Rorug06G0217800
rosa_samantha Rh6AG328000 Rh6BG335500 Rh6CG341700 Rh6DG328900
rosa_wichuraiana Rw6G028530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 293
AccI GTMKAC 1 cut(s) 488
AccIII TCCGGA 1 cut(s) 209
AcsI RAATTY 3 cut(s) 97, 148, 520
AgsI TTSAA 4 cut(s) 35, 148, 153, 359
AjnI CCWGG 2 cut(s) 217, 237
AluBI AGCT 2 cut(s) 323, 362
AluI AGCT 2 cut(s) 323, 362
Alw21I GWGCWC 1 cut(s) 331
Alw26I GTCTC 1 cut(s) 163
Aor13HI TCCGGA 1 cut(s) 209
AoxI GGCC 1 cut(s) 388
ApeKI GCWGC 3 cut(s) 5, 52, 340
ApoI RAATTY 3 cut(s) 97, 148, 520
Asp700I GAANNNNTTC 1 cut(s) 537
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 3 cut(s) 116, 393, 519
AvaII GGWCC 1 cut(s) 215
BanI GGYRCC 1 cut(s) 293
BauI CACGAG 1 cut(s) 348
BbsI GAAGAC 1 cut(s) 447
Bbv12I GWGCWC 1 cut(s) 331
BbvI GCAGC 2 cut(s) 39, 327
BccI CCATC 1 cut(s) 129
BceAI ACGGC 1 cut(s) 40
BciT130I CCWGG 2 cut(s) 219, 239
BclI TGATCA 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 3 cut(s) 159, 246, 386
BisI GCNGC 3 cut(s) 6, 53, 341
BlsI GCNGC 3 cut(s) 7, 54, 342
Bme1390I CCNGG 2 cut(s) 219, 239
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 2 cut(s) 107, 295
BmrFI CCNGG 2 cut(s) 219, 239
BpiI GAAGAC 1 cut(s) 447
BsaI GGTCTC 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 209
BseAI TCCGGA 1 cut(s) 209
BseBI CCWGG 2 cut(s) 219, 239
BseGI GGATG 3 cut(s) 76, 206, 484
BseXI GCAGC 2 cut(s) 39, 327
BshFI GGCC 1 cut(s) 390
BshNI GGYRCC 1 cut(s) 293
BsiHKAI GWGCWC 1 cut(s) 331
BsiSI CCGG 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 163
BsmI GAATGC 1 cut(s) 228
BsnI GGCC 1 cut(s) 390
Bso31I GGTCTC 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 331
Bsp13I TCCGGA 1 cut(s) 209
Bsp143I GATC 2 cut(s) 139, 421
BspANI GGCC 1 cut(s) 390
BspEI TCCGGA 1 cut(s) 209
BspHI TCATGA 1 cut(s) 10
BspLI GGNNCC 2 cut(s) 107, 295
BspT107I GGYRCC 1 cut(s) 293
BspTNI GGTCTC 1 cut(s) 163
BssMI GATC 2 cut(s) 139, 421
BssSI CACGAG 1 cut(s) 348
Bst2BI CACGAG 1 cut(s) 348
Bst2UI CCWGG 2 cut(s) 219, 239
Bst6I CTCTTC 1 cut(s) 15
BstC8I GCNNGC 3 cut(s) 228, 292, 392
BstF5I GGATG 3 cut(s) 76, 206, 484
BstKTI GATC 2 cut(s) 142, 424
BstMAI GTCTC 1 cut(s) 163
BstMBI GATC 2 cut(s) 139, 421
BstNI CCWGG 2 cut(s) 219, 239
BstSCI CCNGG 2 cut(s) 217, 237
BstV1I GCAGC 2 cut(s) 39, 327
BstV2I GAAGAC 1 cut(s) 447
BstXI CCANNNNNNTGG 2 cut(s) 238, 552
BsuRI GGCC 1 cut(s) 390
BtsCI GGATG 3 cut(s) 76, 206, 484
Cac8I GCNNGC 3 cut(s) 228, 292, 392
CciI TCATGA 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 215
CviAII CATG 5 cut(s) 11, 110, 194, 258, 380
CviJI RGCY 8 cut(s) 5, 52, 106, 230, 249, 323, 362, 390
CviKI_1 RGCY 8 cut(s) 5, 52, 106, 230, 249, 323, 362, 390
DpnI GATC 2 cut(s) 141, 423
DpnII GATC 2 cut(s) 139, 421
DraI TTTAAA 1 cut(s) 418
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco147I AGGCCT 1 cut(s) 390
Eco31I GGTCTC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 215
EcoO109I RGGNCCY 1 cut(s) 215
EcoRI GAATTC 2 cut(s) 148, 520
EcoRII CCWGG 2 cut(s) 217, 237
FaeI CATG 5 cut(s) 14, 113, 197, 261, 383
FaiI YATR 7 cut(s) 12, 82, 111, 180, 195, 259, 381
FatI CATG 5 cut(s) 10, 109, 193, 257, 379
FbaI TGATCA 1 cut(s) 139
FblI GTMKAC 1 cut(s) 488
Fnu4HI GCNGC 3 cut(s) 6, 53, 341
FokI GGATG 3 cut(s) 83, 193, 491
Fsp4HI GCNGC 3 cut(s) 6, 53, 341
FspBI CTAG 3 cut(s) 159, 246, 386
GluI GCNGC 3 cut(s) 6, 53, 341
HaeIII GGCC 1 cut(s) 390
HapII CCGG 1 cut(s) 210
Hin1II CATG 5 cut(s) 14, 113, 197, 261, 383
HinfI GANTC 1 cut(s) 242
HpaII CCGG 1 cut(s) 210
HphI GGTGA 3 cut(s) 116, 393, 519
Hpy166II GTNNAC 1 cut(s) 489
Hpy188I TCNGA 2 cut(s) 366, 519
Hpy188III TCNNGA 2 cut(s) 11, 210
Hpy8I GTNNAC 1 cut(s) 489
HpyAV CCTTC 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 375
HpyCH4V TGCA 4 cut(s) 113, 226, 383, 394
HpySE526I ACGT 1 cut(s) 375
Hsp92II CATG 5 cut(s) 14, 113, 197, 261, 383
Kpn2I TCCGGA 1 cut(s) 209
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 2 cut(s) 139, 421
LmnI GCTCC 2 cut(s) 111, 334
LpnPI CCDG 9 cut(s) 204, 223, 224, 231, 251, 276, 333, 404, 543
Lsp1109I GCAGC 2 cut(s) 39, 327
MaeI CTAG 3 cut(s) 159, 246, 386
MaeII ACGT 1 cut(s) 375
MaeIII GTNAC 2 cut(s) 57, 83
MalI GATC 2 cut(s) 141, 423
MboI GATC 2 cut(s) 139, 421
MboII GAAGA 8 cut(s) 26, 29, 32, 47, 269, 452, 516, 533
MhlI GDGCHC 1 cut(s) 331
MluCI AATT 5 cut(s) 97, 148, 199, 520, 533
MnlI CCTC 5 cut(s) 96, 206, 355, 380, 414
MroI TCCGGA 1 cut(s) 209
MroXI GAANNNNTTC 1 cut(s) 537
MseI TTAA 1 cut(s) 417
MslI CAYNNNNRTG 1 cut(s) 135
MspI CCGG 1 cut(s) 210
MspR9I CCNGG 2 cut(s) 219, 239
Mva1269I GAATGC 1 cut(s) 228
MvaI CCWGG 2 cut(s) 219, 239
NdeII GATC 2 cut(s) 139, 421
NlaIII CATG 5 cut(s) 14, 113, 197, 261, 383
NlaIV GGNNCC 2 cut(s) 107, 295
NmuCI GTSAC 2 cut(s) 57, 83
PagI TCATGA 1 cut(s) 10
PceI AGGCCT 1 cut(s) 390
PctI GAATGC 1 cut(s) 228
PdmI GAANNNNTTC 1 cut(s) 537
PfeI GAWTC 1 cut(s) 242
PfoI TCCNGGA 1 cut(s) 237
PkrI GCNGC 3 cut(s) 7, 54, 342
PpuMI RGGWCCY 1 cut(s) 215
Psp5II RGGWCCY 1 cut(s) 215
Psp6I CCWGG 2 cut(s) 217, 237
PspGI CCWGG 2 cut(s) 217, 237
PspN4I GGNNCC 2 cut(s) 107, 295
PspPI GGNCC 1 cut(s) 215
PspPPI RGGWCCY 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 135
SaqAI TTAA 1 cut(s) 417
SatI GCNGC 3 cut(s) 6, 53, 341
Sau3AI GATC 2 cut(s) 139, 421
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 2 cut(s) 219, 239
SduI GDGCHC 1 cut(s) 331
SetI ASST 6 cut(s) 220, 325, 364, 372, 378, 406
SinI GGWCC 1 cut(s) 215
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 5 cut(s) 97, 148, 199, 520, 533
SseBI AGGCCT 1 cut(s) 390
SspMI CTAG 3 cut(s) 159, 246, 386
StuI AGGCCT 1 cut(s) 390
StyD4I CCNGG 2 cut(s) 217, 237
TaiI ACGT 1 cut(s) 378
TaqI TCGA 2 cut(s) 101, 406
TasI AATT 5 cut(s) 97, 148, 199, 520, 533
TfiI GAWTC 1 cut(s) 242
Tru1I TTAA 1 cut(s) 417
Tru9I TTAA 1 cut(s) 417
TseFI GTSAC 2 cut(s) 57, 83
TseI GCWGC 3 cut(s) 5, 52, 340
Tsp45I GTSAC 2 cut(s) 57, 83
TspDTI ATGAA 2 cut(s) 27, 87
VpaK11BI GGWCC 1 cut(s) 215
XapI RAATTY 3 cut(s) 97, 148, 520
XcmI CCANNNNNNNNNTGG 1 cut(s) 257
XmiI GTMKAC 1 cut(s) 488
XmnI GAANNNNTTC 1 cut(s) 537
XspI CTAG 3 cut(s) 159, 246, 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.