MD09G1062400.v1.1

Belongs to the complex I LYR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0012215
Physical Location & Seq
Forward (+)
4240787 .. 4242961
2175 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1062400.v1.1.491

Sequence Viewer

Length: 327 bp
ATGGTTGTGGTGGCCCGGGCTTCTTCTCGGGCTGAGGTGCTCACGATGTTCCGCTCTTTCCTTCGAGTGGCTCGTAAGTTCACCGACTACAACATCAGGGAGTACACGAAACGCCGAACCGTCGACGGTTTTCGTCAGAATCGGAACCTTTCGGACCCGTCTGCCATCTCCTCCGCCTTCTCAGACGGGAAGGCTCAGCTGGAGGTCGCCAATCGGCAGGCTCTCGTTTACTCTCTCTACGCTCCTAAGCTCAAGAGCGTCATGGAGGTTTGCCAGACCTTCACTTCTACTGACAAGCGATTTCATGGAACTTTTATAACGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Complex1_LYR

Protein Analysis

109

Amino Acids

12.37

Weight (kDa)

10.33

Isoelectric Point (pI)

40.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Complex1_LYR PF05347 12 - 69 4.1e-19 Complex 1 protein (LYR family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 317
AccBSI CCGCTC 1 cut(s) 54
AccI GTMKAC 1 cut(s) 123
AciI CCGC 2 cut(s) 52, 174
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 67
AluBI AGCT 2 cut(s) 199, 250
AluI AGCT 2 cut(s) 199, 250
Alw21I GWGCWC 1 cut(s) 42
Ama87I CYCGRG 2 cut(s) 15, 27
AoxI GGCC 1 cut(s) 12
AspS9I GGNCC 2 cut(s) 13, 154
AsuC2I CCSGG 2 cut(s) 16, 17
AsuHPI GGTGA 1 cut(s) 73
AvaI CYCGRG 2 cut(s) 15, 27
AvaII GGWCC 1 cut(s) 154
Bbv12I GWGCWC 1 cut(s) 42
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 173
BcnI CCSGG 2 cut(s) 16, 17
BfmI CTRYAG 1 cut(s) 323
BlpI GCTNAGC 1 cut(s) 195
Bme1390I CCNGG 2 cut(s) 16, 17
Bme18I GGWCC 1 cut(s) 154
BmeT110I CYCGRG 2 cut(s) 15, 27
BmgT120I GGNCC 2 cut(s) 13, 154
BmiI GGNNCC 2 cut(s) 146, 156
BmrFI CCNGG 2 cut(s) 16, 17
BpmI CTGGAG 1 cut(s) 221
Bpu10I CCTNAGC 2 cut(s) 33, 246
Bpu1102I GCTNAGC 1 cut(s) 195
BpuEI CTTGAG 1 cut(s) 236
BpuMI CCSGG 2 cut(s) 16, 17
BsaJI CCNNGG 1 cut(s) 15
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMII CTCAG 3 cut(s) 24, 195, 209
BseRI GAGGAG 1 cut(s) 160
BshFI GGCC 1 cut(s) 14
BsiHKAI GWGCWC 1 cut(s) 42
BsiHKCI CYCGRG 2 cut(s) 15, 27
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 67
BsnI GGCC 1 cut(s) 14
BsoBI CYCGRG 2 cut(s) 15, 27
Bsp1286I GDGCHC 1 cut(s) 42
Bsp1720I GCTNAGC 1 cut(s) 195
BspACI CCGC 2 cut(s) 52, 174
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 3 cut(s) 25, 194, 208
BspLI GGNNCC 2 cut(s) 146, 156
BsrBI CCGCTC 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 15
Bst4CI ACNGT 2 cut(s) 121, 128
BstC8I GCNNGC 1 cut(s) 219
BstDEI CTNAG 4 cut(s) 33, 181, 195, 246
BstSCI CCNGG 2 cut(s) 14, 15
BstSFI CTRYAG 1 cut(s) 323
BsuRI GGCC 1 cut(s) 14
Cac8I GCNNGC 1 cut(s) 219
Cfr13I GGNCC 2 cut(s) 13, 154
Cfr9I CCCGGG 1 cut(s) 15
CseI GACGC 1 cut(s) 247
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 262, 305
CviJI RGCY 8 cut(s) 14, 20, 32, 71, 194, 199, 221, 250
CviKI_1 RGCY 8 cut(s) 14, 20, 32, 71, 194, 199, 221, 250
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 4 cut(s) 33, 181, 195, 246
EciI GGCGGA 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 154
Eco88I CYCGRG 2 cut(s) 15, 27
FaeI CATG 2 cut(s) 265, 308
FaiI YATR 3 cut(s) 263, 306, 317
FatI CATG 2 cut(s) 261, 304
FblI GTMKAC 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 221
HaeIII GGCC 1 cut(s) 14
HapII CCGG 1 cut(s) 16
HgaI GACGC 1 cut(s) 247
Hin1II CATG 2 cut(s) 265, 308
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
HinfI GANTC 1 cut(s) 139
HpaII CCGG 1 cut(s) 16
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 4 cut(s) 81, 105, 124, 229
Hpy188I TCNGA 4 cut(s) 138, 144, 154, 184
Hpy188III TCNNGA 2 cut(s) 43, 253
Hpy8I GTNNAC 4 cut(s) 81, 105, 124, 229
Hpy99I CGWCG 2 cut(s) 125, 128
HpyAV CCTTC 4 cut(s) 71, 184, 187, 289
HpyCH4III ACNGT 2 cut(s) 121, 128
HpyF3I CTNAG 4 cut(s) 33, 181, 195, 246
Hsp92II CATG 2 cut(s) 265, 308
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 5 cut(s) 29, 82, 185, 203, 287
MbiI CCGCTC 1 cut(s) 54
MboII GAAGA 1 cut(s) 15
MhlI GDGCHC 1 cut(s) 42
MnlI CCTC 4 cut(s) 28, 181, 196, 259
MspA1I CMGCKG 1 cut(s) 199
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 2 cut(s) 16, 17
NciI CCSGG 2 cut(s) 16, 17
NlaIII CATG 2 cut(s) 265, 308
NlaIV GGNNCC 2 cut(s) 146, 156
PcsI WCGNNNNNNNCGW 1 cut(s) 70
PfeI GAWTC 1 cut(s) 139
PsiI TTATAA 1 cut(s) 317
PspN4I GGNNCC 2 cut(s) 146, 156
PspPI GGNCC 2 cut(s) 13, 154
PvuII CAGCTG 1 cut(s) 199
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
SalI GTCGAC 1 cut(s) 122
Sau96I GGNCC 2 cut(s) 13, 154
ScrFI CCNGG 2 cut(s) 16, 17
SduI GDGCHC 1 cut(s) 42
SetI ASST 7 cut(s) 39, 150, 201, 207, 252, 270, 281
SfcI CTRYAG 1 cut(s) 323
SgrDI CGTCGACG 1 cut(s) 122
SinI GGWCC 1 cut(s) 154
SmaI CCCGGG 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
SrfI GCCCGGGC 1 cut(s) 17
SsiI CCGC 2 cut(s) 52, 174
StyD4I CCNGG 2 cut(s) 14, 15
TaaI ACNGT 2 cut(s) 121, 128
TaqI TCGA 2 cut(s) 64, 123
TatI WGTACW 1 cut(s) 102
TfiI GAWTC 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 293
TspMI CCCGGG 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 154
XmaI CCCGGG 1 cut(s) 15
XmiI GTMKAC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.