MD10G1227700.v1.1

Required for the assembly of the V0 complex of the vacuolar ATPase (V-ATPase) in the endoplasmic reticulum

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0011972
Physical Location & Seq
Reverse (-)
32449940 .. 32452452
2513 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1227700.v1.1.491

Sequence Viewer

Length: 282 bp
ATGTTTATGTGGATAATTCCTGTTGCAATATTATATGCGTTTAACAATAATTTGCTTCCTGGTGTAAGCGACATGTCTCCCTATTCACTCACGTTGTTGAGTGGATTCCTTGCTGTTATATCTGTCAACGTAGTTATCGCATTTTACATATACATGGCAATGAAAGAGCCTTCAGACCAACACAAGCCTGATCCTGCATTTCTTGCTGAAGCCGAAGCTAGTGTAAGCAAGTTAAAAGGTGATACTGATGGTTCTTCCCAATCCTCCAAGAAAGAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VMA21

Protein Analysis

94

Amino Acids

10.18

Weight (kDa)

4.74

Isoelectric Point (pI)

54.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VMA21 PF09446 1 - 54 2.5e-17 VMA21-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011972)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G05780 AT2G31710
fragaria_vesca FvH4_3g12930 FvH4_4g01060
malus_domestica MD05G1247100.v1.1 MD10G1227700.v1.1
prunus_persica Prupe.4G117300_v2.0.a1 Prupe.4G117300_v2.0.a1
pyrus_communis pycom05g22300 pycom10g19120
rosa_chinensis RchiOBHm_Chr5g0021041
rosa_laevigata RLG00000032578
rosa_multiflora Rmu_co8487873.1_g000001
rosa_rugosa Rorug05G0063800
rosa_samantha Rh5AG153400 Rh5BG153100 Rh5CG165900 Rh5DG152700
rosa_wichuraiana Rw5G013630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 185
AcuI CTGAAG 2 cut(s) 156, 228
AflIII ACRYGT 1 cut(s) 72
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
Alw26I GTCTC 1 cut(s) 81
AlwI GGATC 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 251
BccI CCATC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 81
BfaI CTAG 1 cut(s) 219
Bme1390I CCNGG 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 60
Bse3DI GCAATG 1 cut(s) 165
BseBI CCWGG 1 cut(s) 60
BseMI GCAATG 1 cut(s) 165
BsmAI GTCTC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 190
BspPI GGATC 1 cut(s) 185
BsrDI GCAATG 1 cut(s) 165
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 270
BstAPI GCANNNNNTGC 1 cut(s) 203
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 81
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 58
CviAII CATG 2 cut(s) 73, 154
CviJI RGCY 4 cut(s) 169, 187, 212, 218
CviKI_1 RGCY 4 cut(s) 169, 187, 212, 218
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
Eco57I CTGAAG 2 cut(s) 156, 228
EcoRII CCWGG 1 cut(s) 58
FaeI CATG 2 cut(s) 76, 157
FaiI YATR 8 cut(s) 8, 34, 36, 74, 119, 149, 151, 155
FatI CATG 2 cut(s) 72, 153
FspBI CTAG 1 cut(s) 219
Hin1II CATG 2 cut(s) 76, 157
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 1 cut(s) 105
HphI GGTGA 1 cut(s) 251
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 175
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 180
HpyCH4IV ACGT 2 cut(s) 92, 129
HpyCH4V TGCA 2 cut(s) 26, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpySE526I ACGT 2 cut(s) 92, 129
Hsp92II CATG 2 cut(s) 76, 157
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 5 cut(s) 33, 45, 72, 201, 207
MaeI CTAG 1 cut(s) 219
MaeII ACGT 2 cut(s) 92, 129
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 1 cut(s) 246
MluCI AATT 2 cut(s) 15, 49
MnlI CCTC 1 cut(s) 274
MseI TTAA 2 cut(s) 42, 233
MslI CAYNNNNRTG 2 cut(s) 152, 158
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 1 cut(s) 190
NlaIII CATG 2 cut(s) 76, 157
NspI RCATGY 1 cut(s) 76
PciI ACATGT 1 cut(s) 72
PfeI GAWTC 1 cut(s) 105
PscI ACATGT 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
RseI CAYNNNNRTG 2 cut(s) 152, 158
SaqAI TTAA 2 cut(s) 42, 233
Sau3AI GATC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 60
SetI ASST 4 cut(s) 95, 132, 220, 241
SmiMI CAYNNNNRTG 2 cut(s) 152, 158
Sse9I AATT 2 cut(s) 15, 49
SspI AATATT 1 cut(s) 30
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 58
TaiI ACGT 2 cut(s) 95, 132
TasI AATT 2 cut(s) 15, 49
TfiI GAWTC 1 cut(s) 105
Tru1I TTAA 2 cut(s) 42, 233
Tru9I TTAA 2 cut(s) 42, 233
TspDTI ATGAA 1 cut(s) 176
XceI RCATGY 1 cut(s) 76
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.