Prupe.4G117300_v2.0.a1

Required for the assembly of the V0 complex of the vacuolar ATPase (V-ATPase) in the endoplasmic reticulum

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
6346878 .. 6350410
3533 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G117300.1

Sequence Viewer

Length: 318 bp
ATGGCAGGAGTAATACAAAAGTTCGTTACTGCATCATTGTTTATGTGGATAACTCCCGTGGTGATATTATATGCGTTTAACAATAATTGGCTTCCTGGTGCAAGCGACATGTCTCCATATTCACTCACATTGTTGAGTGGTTTCCTTGCTGTTATATCTGTCAACATAGTTATTGCATTTTATATATATATGGCAATGAAGGAACCTTCTGACAAACATAAGCCTGATCCTGCATTTCTTGCTGAGGCCAAAGCTAGTGTAAACCAGCCTACAGTTGAAGCTGATAGCTCTTCCCAATCCTCCAAGAAAGAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.51

Weight (kDa)

5.25

Isoelectric Point (pI)

59.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011972)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AflIII ACRYGT 1 cut(s) 108
AgsI TTSAA 1 cut(s) 278
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 3 cut(s) 254, 281, 288
AluI AGCT 3 cut(s) 254, 281, 288
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 221
AoxI GGCC 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 73
BbvCI CCTCAGC 1 cut(s) 243
BciT130I CCWGG 1 cut(s) 96
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 1 cut(s) 255
BfmI CTRYAG 1 cut(s) 270
Bme1390I CCNGG 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 41
Bpu10I CCTNAGC 1 cut(s) 243
BsaJI CCNNGG 1 cut(s) 57
Bse3DI GCAATG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 57
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 234
BshFI GGCC 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 117
BsnI GGCC 1 cut(s) 248
Bsp143I GATC 1 cut(s) 226
BspANI GGCC 1 cut(s) 248
BspCNI CTCAG 1 cut(s) 235
BspLI GGNNCC 1 cut(s) 204
BspPI GGATC 1 cut(s) 221
BspQI GCTCTTC 1 cut(s) 295
BsrDI GCAATG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 226
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 274
Bst6I CTCTTC 2 cut(s) 295, 306
BstAPI GCANNNNNTGC 1 cut(s) 239
BstC8I GCNNGC 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 243
BstDSI CCRYGG 1 cut(s) 57
BstKTI GATC 1 cut(s) 229
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 270
BsuRI GGCC 1 cut(s) 248
BtgI CCRYGG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 103
CviAII CATG 1 cut(s) 109
CviJI RGCY 7 cut(s) 91, 223, 248, 254, 268, 281, 288
CviKI_1 RGCY 7 cut(s) 91, 223, 248, 254, 268, 281, 288
DdeI CTNAG 1 cut(s) 243
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eam1104I CTCTTC 2 cut(s) 295, 306
EarI CTCTTC 2 cut(s) 295, 306
EcoRII CCWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 112
FatI CATG 1 cut(s) 108
FspBI CTAG 1 cut(s) 255
HaeIII GGCC 1 cut(s) 248
Hin1II CATG 1 cut(s) 112
HincII GTYRAC 1 cut(s) 163
HindII GTYRAC 1 cut(s) 163
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 2 cut(s) 163, 262
Hpy188I TCNGA 1 cut(s) 211
Hpy8I GTNNAC 2 cut(s) 163, 262
HpyAV CCTTC 2 cut(s) 193, 216
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4V TGCA 4 cut(s) 32, 101, 176, 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 243
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 226
LguI GCTCTTC 1 cut(s) 295
LpnPI CCDG 5 cut(s) 81, 108, 237, 243, 278
LweI GCATC 1 cut(s) 41
MaeI CTAG 1 cut(s) 255
MaeIII GTNAC 1 cut(s) 25
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 1 cut(s) 282
MluCI AATT 1 cut(s) 85
MnlI CCTC 2 cut(s) 238, 310
MseI TTAA 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 239
NdeII GATC 1 cut(s) 226
NlaIII CATG 1 cut(s) 112
NlaIV GGNNCC 1 cut(s) 204
NspI RCATGY 1 cut(s) 112
PciI ACATGT 1 cut(s) 108
PciSI GCTCTTC 1 cut(s) 295
PscI ACATGT 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 204
SapI GCTCTTC 1 cut(s) 295
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 1 cut(s) 226
ScrFI CCNGG 1 cut(s) 96
SetI ASST 4 cut(s) 208, 256, 283, 290
SfaNI GCATC 1 cut(s) 41
SfcI CTRYAG 1 cut(s) 270
Sse9I AATT 1 cut(s) 85
SspMI CTAG 1 cut(s) 255
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 274
TasI AATT 1 cut(s) 85
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 212
XceI RCATGY 1 cut(s) 112
XspI CTAG 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.