MD13G1009000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
548711 .. 552835
4125 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1009000.v1.1.491

Sequence Viewer

Length: 414 bp
ATGGAGGAGCAGACCGCACAGACTGATACAACTGCTTCAGATAGAACTCATACCGTCGTGTTGGATATTGAGAGCCTTACACAACTCTCAGATAGAAGCTCCGGAAGCCCCAAAATGACAAGAGCACTCTCAAGAAAATGGTCTTATCGAGCAGAGAGATTGATTAGTAATGACGAGGAGGACACGGATGAGCCACCAAAGAAACTTCTAGTGAAAGTGAATTCTCAGTCGGAGCCTTTGAAGCAGTCATTGATCACTGCAAAATCTATTGGGTCAAGCTCAACTGCGCTTACAGGCACTAATCGGTTTATGGCCATCAACCCTCGGAAGATACTTTTTATATTTGCAACAGTGTCCAGTATGGGTACATTAATCCTCATATATTTCACACTGGCTATCAATAGAACAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.21

Weight (kDa)

9.05

Isoelectric Point (pI)

44.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014731)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 101
AciI CCGC 1 cut(s) 15
AcoI YGGCCR 1 cut(s) 312
AcsI RAATTY 1 cut(s) 220
AcuI CTGAAG 1 cut(s) 21
AfaI GTAC 1 cut(s) 367
AgsI TTSAA 1 cut(s) 241
AluBI AGCT 2 cut(s) 99, 279
AluI AGCT 2 cut(s) 99, 279
Alw21I GWGCWC 1 cut(s) 127
Aor13HI TCCGGA 1 cut(s) 101
AoxI GGCC 1 cut(s) 312
ApoI RAATTY 1 cut(s) 220
AseI ATTAAT 1 cut(s) 371
AspLEI GCGC 1 cut(s) 289
BalI TGGCCA 1 cut(s) 314
Bbv12I GWGCWC 1 cut(s) 127
BccI CCATC 1 cut(s) 323
BclI TGATCA 1 cut(s) 252
BfaI CTAG 1 cut(s) 209
BmiI GGNNCC 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 323
BsaWI WCCGGW 1 cut(s) 101
Bse1I ACTGG 2 cut(s) 357, 396
BseAI TCCGGA 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 1 cut(s) 193
BseMII CTCAG 2 cut(s) 102, 239
BseNI ACTGG 2 cut(s) 357, 396
BseRI GAGGAG 2 cut(s) 20, 191
BshFI GGCC 1 cut(s) 314
BsiHKAI GWGCWC 1 cut(s) 127
BsiSI CCGG 1 cut(s) 102
BsnI GGCC 1 cut(s) 314
Bsp1286I GDGCHC 1 cut(s) 127
Bsp13I TCCGGA 1 cut(s) 101
Bsp143I GATC 1 cut(s) 252
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 314
BspCNI CTCAG 2 cut(s) 101, 238
BspEI TCCGGA 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 234
BsrI ACTGG 2 cut(s) 357, 396
BssECI CCNNGG 1 cut(s) 323
BssMI GATC 1 cut(s) 252
Bst4CI ACNGT 3 cut(s) 55, 352, 409
BstDEI CTNAG 2 cut(s) 88, 225
BstF5I GGATG 1 cut(s) 193
BstHHI GCGC 1 cut(s) 289
BstKTI GATC 1 cut(s) 255
BstMBI GATC 1 cut(s) 252
BstMWI GCNNNNNNNGC 2 cut(s) 105, 241
BsuRI GGCC 1 cut(s) 314
BtsCI GGATG 1 cut(s) 193
BtsI GCAGTG 1 cut(s) 255
BtsIMutI CAGTG 3 cut(s) 255, 357, 389
CfoI GCGC 1 cut(s) 289
Csp6I GTAC 1 cut(s) 366
CviJI RGCY 8 cut(s) 75, 99, 108, 193, 235, 279, 314, 395
CviKI_1 RGCY 8 cut(s) 75, 99, 108, 193, 235, 279, 314, 395
CviQI GTAC 1 cut(s) 366
DdeI CTNAG 2 cut(s) 88, 225
DpnI GATC 1 cut(s) 254
DpnII GATC 1 cut(s) 252
EaeI YGGCCR 1 cut(s) 312
Eco57I CTGAAG 1 cut(s) 21
EcoRI GAATTC 1 cut(s) 220
FaiI YATR 6 cut(s) 51, 311, 341, 362, 380, 382
FbaI TGATCA 1 cut(s) 252
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 209
GlaI GCGC 1 cut(s) 288
HaeIII GGCC 1 cut(s) 314
HapII CCGG 1 cut(s) 102
HhaI GCGC 1 cut(s) 289
Hin6I GCGC 1 cut(s) 287
HinP1I GCGC 1 cut(s) 287
HpaII CCGG 1 cut(s) 102
Hpy188I TCNGA 4 cut(s) 40, 91, 232, 327
Hpy188III TCNNGA 2 cut(s) 102, 132
Hpy99I CGWCG 1 cut(s) 59
HpyCH4III ACNGT 3 cut(s) 55, 352, 409
HpyCH4V TGCA 2 cut(s) 260, 347
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 241
HpyF3I CTNAG 2 cut(s) 88, 225
HspAI GCGC 1 cut(s) 287
Kpn2I TCCGGA 1 cut(s) 101
Ksp22I TGATCA 1 cut(s) 252
Kzo9I GATC 1 cut(s) 252
LmnI GCTCC 3 cut(s) 7, 104, 232
LpnPI CCDG 4 cut(s) 115, 279, 370, 377
MaeI CTAG 1 cut(s) 209
MalI GATC 1 cut(s) 254
MboI GATC 1 cut(s) 252
MboII GAAGA 1 cut(s) 340
MhlI GDGCHC 1 cut(s) 127
MlsI TGGCCA 1 cut(s) 314
MluCI AATT 1 cut(s) 220
MluNI TGGCCA 1 cut(s) 314
MmeI TCCRAC 2 cut(s) 42, 210
MnlI CCTC 4 cut(s) 169, 172, 333, 386
Mox20I TGGCCA 1 cut(s) 314
MroI TCCGGA 1 cut(s) 101
MscI TGGCCA 1 cut(s) 314
MseI TTAA 1 cut(s) 371
Msp20I TGGCCA 1 cut(s) 314
MspI CCGG 1 cut(s) 102
MwoI GCNNNNNNNGC 2 cut(s) 105, 241
NdeII GATC 1 cut(s) 252
NlaIV GGNNCC 1 cut(s) 234
PshBI ATTAAT 1 cut(s) 371
PspN4I GGNNCC 1 cut(s) 234
RsaI GTAC 1 cut(s) 367
RsaNI GTAC 1 cut(s) 366
SaqAI TTAA 1 cut(s) 371
Sau3AI GATC 1 cut(s) 252
SduI GDGCHC 1 cut(s) 127
SetI ASST 2 cut(s) 101, 281
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
Sse9I AATT 1 cut(s) 220
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 209
TaaI ACNGT 3 cut(s) 55, 352, 409
TaqI TCGA 1 cut(s) 148
TasI AATT 1 cut(s) 220
Tru1I TTAA 1 cut(s) 371
Tru9I TTAA 1 cut(s) 371
TscAI CASTG 3 cut(s) 262, 357, 396
TspGWI ACGGA 1 cut(s) 200
TspRI CASTG 3 cut(s) 262, 357, 396
VspI ATTAAT 1 cut(s) 371
XapI RAATTY 1 cut(s) 220
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.