MD13G1126900.v1.1

Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0017099
Physical Location & Seq
Forward (+)
9501534 .. 9501878
345 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1126900.v1.1.491

Sequence Viewer

Length: 345 bp
ATGGAGGGTCCCACTCCAGTATCCGCTTCGATTCATGCAGCTACTATGGTAACAGCTGGCGTTTTCATGATAGCAAGGTGCTCCCCTTTATTTGAATACCCACCTACGGCTTTGATTGTTATTACTTTTGCAGGAGCTACGACGTCATTCCTTGCGGCAACCACTGGAATATTACAGAACGATCTAAAGAGGGTCATAGCTTATTCAACTTGCAGTCAATTAGGCTATATGATCTTTGCTTGCGGCATCTCTAACTATTCGATTAGCGTCTTTCACTTAATGAATCACACGTTTTTCAAAGCATTACTATTCCTTGTATCAGGCCTCGGTACGGCCTATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 ko04723 ko05012 map00190 map01100 map04714 map04723 map05012
Pfam Domains
Protein Families
Proton_antipo_M Proton_antipo_N

Protein Analysis

115

Amino Acids

12.16

Weight (kDa)

7.75

Isoelectric Point (pI)

28.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Proton_antipo_M PF00361 1 - 108 6.9e-30 NADH:quinone oxidoreductase/Mrp antiporter, TM
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017099)

Species Orthologous Gene IDs
arabidopsis_thaliana ATMG00513
fragaria_vesca FvH4_6g34420 FvH4_c1g00470
malus_domestica MD13G1126900.v1.1
pyrus_communis pycom12401g00270 pycom17g12740
rosa_chinensis RchiOBHm_MTg0498221
rosa_laevigata RLG00000000086 RLG00000000118 RLG00000000360 RLG00000000372 RLG00000000388
rosa_wichuraiana Rw0G023320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 146
AciI CCGC 3 cut(s) 24, 155, 243
AcyI GRCGYC 1 cut(s) 143
AfaI GTAC 1 cut(s) 331
AfiI CCNNNNNNNGG 2 cut(s) 106, 331
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 3 cut(s) 95, 207, 298
AluBI AGCT 4 cut(s) 41, 56, 137, 200
AluI AGCT 4 cut(s) 41, 56, 137, 200
Alw21I GWGCWC 1 cut(s) 83
AoxI GGCC 2 cut(s) 322, 333
ApeKI GCWGC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 8
AvaII GGWCC 1 cut(s) 8
BaeI ACNNNNGTAYC 1 cut(s) 36
Bbv12I GWGCWC 1 cut(s) 83
BbvI GCAGC 1 cut(s) 50
BceAI ACGGC 1 cut(s) 123
BciVI GTATCC 1 cut(s) 31
BfuI GTATCC 1 cut(s) 31
BisI GCNGC 3 cut(s) 39, 156, 244
BlsI GCNGC 3 cut(s) 40, 157, 245
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 2 cut(s) 9, 10
BmsI GCATC 1 cut(s) 255
BsaHI GRCGYC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 325
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 331
Bse1I ACTGG 2 cut(s) 17, 169
BseDI CCNNGG 1 cut(s) 325
BseLI CCNNNNNNNGG 2 cut(s) 106, 331
BseNI ACTGG 2 cut(s) 17, 169
BseXI GCAGC 1 cut(s) 50
BshFI GGCC 2 cut(s) 324, 335
BsiHKAI GWGCWC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 106, 331
BsnI GGCC 2 cut(s) 324, 335
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 181, 231
BspACI CCGC 3 cut(s) 24, 155, 243
BspANI GGCC 2 cut(s) 324, 335
BspHI TCATGA 1 cut(s) 66
BspLI GGNNCC 2 cut(s) 9, 10
BsrI ACTGG 2 cut(s) 17, 169
BssECI CCNNGG 1 cut(s) 325
BssMI GATC 2 cut(s) 181, 231
BssNI GRCGYC 1 cut(s) 143
BstACI GRCGYC 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 58, 241
BstKTI GATC 2 cut(s) 184, 234
BstMBI GATC 2 cut(s) 181, 231
BstV1I GCAGC 1 cut(s) 50
BsuI GTATCC 1 cut(s) 31
BsuRI GGCC 2 cut(s) 324, 335
BtsIMutI CAGTG 1 cut(s) 162
Cac8I GCNNGC 2 cut(s) 58, 241
CciI TCATGA 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 8
CseI GACGC 1 cut(s) 256
Csp6I GTAC 1 cut(s) 330
CviAII CATG 3 cut(s) 35, 67, 342
CviJI RGCY 8 cut(s) 41, 56, 110, 137, 200, 225, 324, 335
CviKI_1 RGCY 8 cut(s) 41, 56, 110, 137, 200, 225, 324, 335
CviQI GTAC 1 cut(s) 330
DpnI GATC 2 cut(s) 183, 233
DpnII GATC 2 cut(s) 181, 231
Eco147I AGGCCT 1 cut(s) 324
Eco47I GGWCC 1 cut(s) 8
EcoO109I RGGNCCY 1 cut(s) 8
FaeI CATG 3 cut(s) 38, 70, 345
FaiI YATR 8 cut(s) 36, 47, 68, 197, 228, 230, 339, 343
FatI CATG 3 cut(s) 34, 66, 341
Fnu4HI GCNGC 3 cut(s) 39, 156, 244
Fsp4HI GCNGC 3 cut(s) 39, 156, 244
GluI GCNGC 3 cut(s) 39, 156, 244
HaeIII GGCC 2 cut(s) 324, 335
HgaI GACGC 1 cut(s) 256
Hin1I GRCGYC 1 cut(s) 143
Hin1II CATG 3 cut(s) 38, 70, 345
HinfI GANTC 2 cut(s) 31, 283
Hpy188III TCNNGA 1 cut(s) 67
Hpy99I CGWCG 1 cut(s) 145
HpyCH4IV ACGT 2 cut(s) 143, 290
HpyCH4V TGCA 3 cut(s) 38, 131, 213
HpySE526I ACGT 2 cut(s) 143, 290
Hsp92I GRCGYC 1 cut(s) 143
Hsp92II CATG 3 cut(s) 38, 70, 345
KflI GGGWCCC 1 cut(s) 8
Kzo9I GATC 2 cut(s) 181, 231
LmnI GCTCC 2 cut(s) 86, 134
LpnPI CCDG 5 cut(s) 30, 42, 117, 150, 306
Lsp1109I GCAGC 1 cut(s) 50
LweI GCATC 1 cut(s) 255
MaeII ACGT 2 cut(s) 143, 290
MaeIII GTNAC 1 cut(s) 49
MalI GATC 2 cut(s) 183, 233
MboI GATC 2 cut(s) 181, 231
MhlI GDGCHC 1 cut(s) 83
MluCI AATT 1 cut(s) 218
MnlI CCTC 2 cut(s) 183, 335
MseI TTAA 1 cut(s) 278
MspA1I CMGCKG 1 cut(s) 56
NdeII GATC 2 cut(s) 181, 231
NlaIII CATG 3 cut(s) 38, 70, 345
NlaIV GGNNCC 2 cut(s) 9, 10
PagI TCATGA 1 cut(s) 66
PceI AGGCCT 1 cut(s) 324
PfeI GAWTC 2 cut(s) 31, 283
PkrI GCNGC 3 cut(s) 40, 157, 245
PpuMI RGGWCCY 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 9, 10
PspPI GGNCC 1 cut(s) 8
PspPPI RGGWCCY 1 cut(s) 8
PvuII CAGCTG 1 cut(s) 56
RsaI GTAC 1 cut(s) 331
RsaNI GTAC 1 cut(s) 330
SaqAI TTAA 1 cut(s) 278
SatI GCNGC 3 cut(s) 39, 156, 244
Sau3AI GATC 2 cut(s) 181, 231
Sau96I GGNCC 1 cut(s) 8
SduI GDGCHC 1 cut(s) 83
SetI ASST 8 cut(s) 43, 58, 80, 106, 139, 146, 202, 293
SfaNI GCATC 1 cut(s) 255
SinI GGWCC 1 cut(s) 8
Sse9I AATT 1 cut(s) 218
SseBI AGGCCT 1 cut(s) 324
SsiI CCGC 3 cut(s) 24, 155, 243
SspI AATATT 1 cut(s) 171
StuI AGGCCT 1 cut(s) 324
TaiI ACGT 2 cut(s) 146, 293
TaqI TCGA 2 cut(s) 29, 260
TasI AATT 1 cut(s) 218
TauI GCSGC 2 cut(s) 158, 246
TfiI GAWTC 2 cut(s) 31, 283
Tru1I TTAA 1 cut(s) 278
Tru9I TTAA 1 cut(s) 278
TscAI CASTG 1 cut(s) 169
TseI GCWGC 1 cut(s) 38
TspDTI ATGAA 3 cut(s) 23, 55, 296
TspRI CASTG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 8
ZraI GACGTC 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.