MD17G1194600.v1.1

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0014261
Physical Location & Seq
Forward (+)
23311259 .. 23312597
1339 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1194600.v1.1.491

Sequence Viewer

Length: 642 bp
ATGCCCATGGCCACCCCCCGCTCAGAACCACCACCACCCCAACCATGCACCCCATTACTCGCCGACCAAAACTACGTCGTTCTATCACCACCATCTTGTTCTCACTCCCAACGACGGCGCACAACTATCCTAGCCACTACTCTCATACTTACACTCCTAGCCGCCACCTTCTCCGCCTTCCTCCTCTGGCCGTCCGAACCCTCCCTGAAGATCGTACGGCTTCGGCTTAACAAGGTTCAAGTCCACACGCGGCCACGAGTGACCATCGACGTGTCCATGTCGGTGACGATTAAGGTCCAGAACGTTGACGTTTACGCGATGGACTACGAGGCGCTGGAGGTGGCGGTTGGGTACAGAGGGAGGAGGCTGGGGCACGCGACGTTCCAGCAGGGTTACGTGCGGGCGCTTGGCTCGTCGTACTTGGACGCGGAGGTGGAGTTTAATGAGGTCGGGGTGTTTTCCGACGTGGTGCTCCTGCTTGAGGACTTGGCTAAGGGAACGGTGCCGTTTGACACAGTCACGGAGGTCCAAGGGCGGCTCGGCTTCTTGTTTTTTCAGTTCCCCTTGCAGGCAAGAGTTTCGTGTGAAGTTATGGTGAATACAGTAAATCAGACAATTTTTCGTCATAATTGCTATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

214

Amino Acids

23.86

Weight (kDa)

6.9

Isoelectric Point (pI)

49.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LEA_2 PF03168 96 - 194 2.8e-09 Late embryogenesis abundant protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014261)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G52330 AT1G52330
fragaria_vesca FvH4_6g31230 FvH4_6g31230
malus_domestica MD17G1194600.v1.1
prunus_persica Prupe.3G070600_v2.0.a1
pyrus_communis pycom17g20040
rosa_chinensis RchiOBHm_Chr2g0137941
rosa_laevigata RLG00000019692
rosa_multiflora Rmu_sc0002170.1_g000035
rosa_roxburghii Rroxscaffold_2G00106630
rosa_rugosa Rorug02G0348200
rosa_samantha Rh2AG394700 Rh2BG401700 Rh2CG381300 Rh2DG416600
rosa_wichuraiana Rw2G032280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 502
AccBSI CCGCTC 1 cut(s) 21
AccII CGCG 4 cut(s) 250, 317, 377, 428
AciI CCGC 8 cut(s) 19, 162, 174, 250, 344, 400, 428, 535
AclI AACGTT 1 cut(s) 303
AcoI YGGCCR 3 cut(s) 9, 188, 251
AcuI CTGAAG 1 cut(s) 227
AfaI GTAC 3 cut(s) 216, 353, 419
AfiI CCNNNNNNNGG 3 cut(s) 114, 481, 568
AflIII ACRYGT 1 cut(s) 270
AgsI TTSAA 1 cut(s) 239
AjiI CACGTC 2 cut(s) 271, 466
Alw21I GWGCWC 1 cut(s) 474
AoxI GGCC 3 cut(s) 9, 188, 251
AspLEI GCGC 3 cut(s) 120, 334, 406
AspS9I GGNCC 2 cut(s) 295, 526
AsuHPI GGTGA 3 cut(s) 78, 295, 607
AvaII GGWCC 2 cut(s) 295, 526
BaeGI GKGCMC 1 cut(s) 375
BalI TGGCCA 1 cut(s) 11
BanI GGYRCC 1 cut(s) 502
BauI CACGAG 1 cut(s) 255
Bbv12I GWGCWC 1 cut(s) 474
BccI CCATC 3 cut(s) 100, 272, 313
BceAI ACGGC 4 cut(s) 131, 175, 233, 490
BcgI CGANNNNNNTGC 2 cut(s) 561, 595
BfaI CTAG 2 cut(s) 131, 158
BfoI RGCGCY 2 cut(s) 335, 407
BisI GCNGC 3 cut(s) 162, 251, 536
BlsI GCNGC 3 cut(s) 163, 252, 537
Bme18I GGWCC 2 cut(s) 295, 526
BmgBI CACGTC 2 cut(s) 271, 466
BmgT120I GGNCC 2 cut(s) 295, 526
BmiI GGNNCC 1 cut(s) 504
BpmI CTGGAG 1 cut(s) 356
Bpu10I CCTNAGC 1 cut(s) 492
BpuEI CTTGAG 1 cut(s) 500
BsaAI YACGTR 1 cut(s) 397
BsaJI CCNNGG 2 cut(s) 6, 529
BsaXI ACNNNNNCTCC 4 cut(s) 138, 168, 422, 452
Bsc4I CCNNNNNNNGG 3 cut(s) 114, 481, 568
BseDI CCNNGG 2 cut(s) 6, 529
BseLI CCNNNNNNNGG 3 cut(s) 114, 481, 568
BseMII CTCAG 1 cut(s) 36
BseRI GAGGAG 2 cut(s) 173, 376
BseSI GKGCMC 1 cut(s) 375
BseYI CCCAGC 1 cut(s) 367
Bsh1236I CGCG 4 cut(s) 250, 317, 377, 428
BshFI GGCC 3 cut(s) 11, 190, 253
BshNI GGYRCC 1 cut(s) 502
BsiHKAI GWGCWC 1 cut(s) 474
BsiWI CGTACG 1 cut(s) 214
BslI CCNNNNNNNGG 3 cut(s) 114, 481, 568
BsnI GGCC 3 cut(s) 11, 190, 253
Bsp1286I GDGCHC 2 cut(s) 375, 474
Bsp143I GATC 1 cut(s) 210
Bsp19I CCATGG 1 cut(s) 6
BspACI CCGC 8 cut(s) 19, 162, 174, 250, 344, 400, 428, 535
BspANI GGCC 3 cut(s) 11, 190, 253
BspCNI CTCAG 1 cut(s) 35
BspFNI CGCG 4 cut(s) 250, 317, 377, 428
BspLI GGNNCC 1 cut(s) 504
BspT107I GGYRCC 1 cut(s) 502
BsrBI CCGCTC 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 6, 529
BssMI GATC 1 cut(s) 210
BssSI CACGAG 1 cut(s) 255
BssT1I CCWWGG 2 cut(s) 6, 529
Bst2BI CACGAG 1 cut(s) 255
Bst4CI ACNGT 3 cut(s) 502, 517, 604
BstBAI YACGTR 1 cut(s) 397
BstC8I GCNNGC 3 cut(s) 375, 402, 570
BstDEI CTNAG 2 cut(s) 22, 492
BstDSI CCRYGG 1 cut(s) 6
BstENI CCTNNNNNAGG 1 cut(s) 479
BstFNI CGCG 4 cut(s) 250, 317, 377, 428
BstH2I RGCGCY 2 cut(s) 335, 407
BstHHI GCGC 3 cut(s) 120, 334, 406
BstKTI GATC 1 cut(s) 213
BstMBI GATC 1 cut(s) 210
BstSLI GKGCMC 1 cut(s) 375
BstUI CGCG 4 cut(s) 250, 317, 377, 428
BsuRI GGCC 3 cut(s) 11, 190, 253
BtgI CCRYGG 1 cut(s) 6
BtgZI GCGATG 1 cut(s) 332
BtrI CACGTC 2 cut(s) 271, 466
Cac8I GCNNGC 3 cut(s) 375, 402, 570
CfoI GCGC 3 cut(s) 120, 334, 406
Cfr13I GGNCC 2 cut(s) 295, 526
CseI GACGC 1 cut(s) 434
Csp6I GTAC 3 cut(s) 215, 352, 418
CviAII CATG 3 cut(s) 7, 45, 277
CviQI GTAC 3 cut(s) 215, 352, 418
DdeI CTNAG 2 cut(s) 22, 492
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
EaeI YGGCCR 3 cut(s) 9, 188, 251
EciI GGCGGA 1 cut(s) 163
Eco130I CCWWGG 2 cut(s) 6, 529
Eco47I GGWCC 2 cut(s) 295, 526
Eco57I CTGAAG 1 cut(s) 227
EcoNI CCTNNNNNAGG 1 cut(s) 479
EcoT14I CCWWGG 2 cut(s) 6, 529
ErhI CCWWGG 2 cut(s) 6, 529
FaeI CATG 3 cut(s) 10, 48, 280
FaiI YATR 7 cut(s) 8, 46, 146, 278, 593, 627, 636
FatI CATG 3 cut(s) 6, 44, 276
FauI CCCGC 2 cut(s) 26, 393
Fnu4HI GCNGC 3 cut(s) 162, 251, 536
Fsp4HI GCNGC 3 cut(s) 162, 251, 536
FspBI CTAG 2 cut(s) 131, 158
GlaI GCGC 3 cut(s) 119, 333, 405
GluI GCNGC 3 cut(s) 162, 251, 536
GsaI CCCAGC 1 cut(s) 371
GsuI CTGGAG 1 cut(s) 356
HaeII RGCGCY 2 cut(s) 335, 407
HaeIII GGCC 3 cut(s) 11, 190, 253
HgaI GACGC 1 cut(s) 434
HhaI GCGC 3 cut(s) 120, 334, 406
Hin1II CATG 3 cut(s) 10, 48, 280
Hin6I GCGC 3 cut(s) 118, 332, 404
HinP1I GCGC 3 cut(s) 118, 332, 404
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HphI GGTGA 3 cut(s) 78, 295, 607
Hpy166II GTNNAC 3 cut(s) 244, 307, 313
Hpy188I TCNGA 4 cut(s) 25, 196, 463, 612
Hpy188III TCNNGA 1 cut(s) 298
Hpy8I GTNNAC 3 cut(s) 244, 307, 313
Hpy99I CGWCG 6 cut(s) 80, 117, 272, 382, 418, 467
HpyAV CCTTC 2 cut(s) 178, 187
HpyCH4III ACNGT 3 cut(s) 502, 517, 604
HpyCH4IV ACGT 7 cut(s) 75, 270, 303, 309, 380, 396, 465
HpyCH4V TGCA 2 cut(s) 48, 568
HpyF3I CTNAG 2 cut(s) 22, 492
HpySE526I ACGT 7 cut(s) 75, 270, 303, 309, 380, 396, 465
Hsp92II CATG 3 cut(s) 10, 48, 280
HspAI GCGC 3 cut(s) 118, 332, 404
Kzo9I GATC 1 cut(s) 210
LmnI GCTCC 1 cut(s) 477
LpnPI CCDG 9 cut(s) 172, 218, 311, 320, 353, 374, 398, 488, 554
MaeI CTAG 2 cut(s) 131, 158
MaeII ACGT 7 cut(s) 75, 270, 303, 309, 380, 396, 465
MaeIII GTNAC 4 cut(s) 259, 283, 392, 517
MalI GATC 1 cut(s) 212
MbiI CCGCTC 1 cut(s) 21
MboI GATC 1 cut(s) 210
MboII GAAGA 1 cut(s) 220
MhlI GDGCHC 2 cut(s) 375, 474
MlsI TGGCCA 1 cut(s) 11
MluCI AATT 2 cut(s) 615, 628
MluNI TGGCCA 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 486
Mox20I TGGCCA 1 cut(s) 11
MscI TGGCCA 1 cut(s) 11
MseI TTAA 3 cut(s) 228, 291, 441
MslI CAYNNNNRTG 2 cut(s) 269, 281
Msp20I TGGCCA 1 cut(s) 11
MvnI CGCG 4 cut(s) 250, 317, 377, 428
NcoI CCATGG 1 cut(s) 6
NdeII GATC 1 cut(s) 210
NlaIII CATG 3 cut(s) 10, 48, 280
NlaIV GGNNCC 1 cut(s) 504
NmeAIII GCCGAG 1 cut(s) 519
NmuCI GTSAC 3 cut(s) 259, 283, 517
Pfl23II CGTACG 1 cut(s) 214
PflFI GACNNNGTC 1 cut(s) 515
PkrI GCNGC 3 cut(s) 163, 252, 537
Ppu21I YACGTR 1 cut(s) 397
Psp1406I AACGTT 1 cut(s) 303
PspFI CCCAGC 1 cut(s) 367
PspLI CGTACG 1 cut(s) 214
PspN4I GGNNCC 1 cut(s) 504
PspPI GGNCC 2 cut(s) 295, 526
PsyI GACNNNGTC 1 cut(s) 515
RsaI GTAC 3 cut(s) 216, 353, 419
RsaNI GTAC 3 cut(s) 215, 352, 418
RseI CAYNNNNRTG 2 cut(s) 269, 281
SaqAI TTAA 3 cut(s) 228, 291, 441
SatI GCNGC 3 cut(s) 162, 251, 536
Sau3AI GATC 1 cut(s) 210
Sau96I GGNCC 2 cut(s) 295, 526
SduI GDGCHC 2 cut(s) 375, 474
SinI GGWCC 2 cut(s) 295, 526
SmiMI CAYNNNNRTG 2 cut(s) 269, 281
SmlI CTYRAG 1 cut(s) 479
SmoI CTYRAG 1 cut(s) 479
Sse9I AATT 2 cut(s) 615, 628
SsiI CCGC 8 cut(s) 19, 162, 174, 250, 344, 400, 428, 535
SspMI CTAG 2 cut(s) 131, 158
StyI CCWWGG 2 cut(s) 6, 529
TaaI ACNGT 3 cut(s) 502, 517, 604
TaiI ACGT 7 cut(s) 78, 273, 306, 312, 383, 399, 468
TaqI TCGA 1 cut(s) 267
TasI AATT 2 cut(s) 615, 628
TauI GCSGC 3 cut(s) 164, 253, 538
Tru1I TTAA 3 cut(s) 228, 291, 441
Tru9I TTAA 3 cut(s) 228, 291, 441
TseFI GTSAC 3 cut(s) 259, 283, 517
Tsp45I GTSAC 3 cut(s) 259, 283, 517
TspGWI ACGGA 1 cut(s) 536
Tth111I GACNNNGTC 1 cut(s) 515
VpaK11BI GGWCC 2 cut(s) 295, 526
XagI CCTNNNNNAGG 1 cut(s) 479
XspI CTAG 2 cut(s) 131, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.