Prupe.2G016000_v2.0.a1

Protein of unknown function (DUF1092)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
1482810 .. 1484878
2069 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G016000.1

Sequence Viewer

Length: 510 bp
ATGTCACTTGGGAATGGTTCAATTCGTATGATTGCGTTTTGTTCAATGGATTATAGGTCACAGATGCAGACAATTATAACAAAAGCGTGCAACGAGCTTGGTATAAAACCCATTCCCAGTAAACGGTGTCTCTCGTTACTTTTATGGTTGGAAGAACGCTACGAGACTGTATACACACGCCATCCTGGTTTCCAGAAAGGATCTAAGCCACTCCTTGCAGTAGATAACCCATTCCCAATGGAACTTCCAGAAAATCTTGTTGGGGAGAAATGGGCCTTTGTCCAATTGCCCTTTTCAGCTGTTCAAGAGGAAATCTCATCCTTGGACTCAAACCTCGTGTTTGGTGCGAGTCTAGATTTGGATTTGTTGGGGATTGAAATTGACGACAAGACATTGATTCCAGGATTGGCTGTTGCATCTTCACCTTGGATGAATGGGTTGGAAGTTTGTTCAATTGAAGCCGATTTGTCACGGGCTCGCTTGATTCTTTCTGTTGGAATTTCTGGATGA

Protein Analysis

170

Amino Acids

18.59

Weight (kDa)

4.79

Isoelectric Point (pI)

40.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 77
AccI GTMKAC 1 cut(s) 171
AclWI GGATC 1 cut(s) 208
AcsI RAATTY 1 cut(s) 498
AfiI CCNNNNNNNGG 1 cut(s) 123
AgsI TTSAA 6 cut(s) 21, 45, 305, 377, 453, 458
AjnI CCWGG 2 cut(s) 184, 400
AjuI GAANNNNNNNTTGG 2 cut(s) 243, 275
AluBI AGCT 2 cut(s) 97, 299
AluI AGCT 2 cut(s) 97, 299
Alw26I GTCTC 2 cut(s) 134, 158
AlwI GGATC 1 cut(s) 208
AoxI GGCC 1 cut(s) 273
ApoI RAATTY 1 cut(s) 498
AspS9I GGNCC 1 cut(s) 273
AsuHPI GGTGA 1 cut(s) 414
BanII GRGCYC 1 cut(s) 478
BauI CACGAG 1 cut(s) 335
BccI CCATC 1 cut(s) 189
BciT130I CCWGG 2 cut(s) 186, 402
BcoDI GTCTC 2 cut(s) 134, 158
BfaI CTAG 1 cut(s) 353
Bme1390I CCNGG 2 cut(s) 186, 402
BmgT120I GGNCC 1 cut(s) 273
BmrFI CCNGG 2 cut(s) 186, 402
BmrI ACTGGG 1 cut(s) 111
BmsI GCATC 2 cut(s) 54, 425
BmuI ACTGGG 1 cut(s) 111
BplI GAGNNNNNCTC 2 cut(s) 299, 331
BsaJI CCNNGG 2 cut(s) 321, 425
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 2 cut(s) 186, 402
BseDI CCNNGG 2 cut(s) 321, 425
BseGI GGATG 3 cut(s) 181, 317, 435
BseLI CCNNNNNNNGG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 117
BshFI GGCC 1 cut(s) 275
BslI CCNNNNNNNGG 1 cut(s) 123
BsmAI GTCTC 2 cut(s) 134, 158
BsnI GGCC 1 cut(s) 275
Bsp1286I GDGCHC 1 cut(s) 478
Bsp143I GATC 1 cut(s) 200
BspANI GGCC 1 cut(s) 275
BspPI GGATC 1 cut(s) 208
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 321, 425
BssMI GATC 1 cut(s) 200
BssNAI GTATAC 1 cut(s) 172
BssSI CACGAG 1 cut(s) 335
BssT1I CCWWGG 2 cut(s) 321, 425
Bst1107I GTATAC 1 cut(s) 172
Bst2BI CACGAG 1 cut(s) 335
Bst2UI CCWGG 2 cut(s) 186, 402
Bst4CI ACNGT 2 cut(s) 126, 169
BstC8I GCNNGC 2 cut(s) 88, 478
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 3 cut(s) 181, 317, 435
BstKTI GATC 1 cut(s) 203
BstMAI GTCTC 2 cut(s) 134, 158
BstMBI GATC 1 cut(s) 200
BstNI CCWGG 2 cut(s) 186, 402
BstSCI CCNGG 2 cut(s) 184, 400
BstX2I RGATCY 1 cut(s) 200
BstYI RGATCY 1 cut(s) 200
BstZ17I GTATAC 1 cut(s) 172
BsuRI GGCC 1 cut(s) 275
BtsCI GGATG 3 cut(s) 181, 317, 435
Cac8I GCNNGC 2 cut(s) 88, 478
Cfr13I GGNCC 1 cut(s) 273
CviJI RGCY 7 cut(s) 97, 208, 275, 299, 410, 461, 476
CviKI_1 RGCY 7 cut(s) 97, 208, 275, 299, 410, 461, 476
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 202
DpnII GATC 1 cut(s) 200
Eco130I CCWWGG 2 cut(s) 321, 425
Eco24I GRGCYC 1 cut(s) 478
EcoRII CCWGG 2 cut(s) 184, 400
EcoT14I CCWWGG 2 cut(s) 321, 425
EcoT38I GRGCYC 1 cut(s) 478
ErhI CCWWGG 2 cut(s) 321, 425
FaiI YATR 6 cut(s) 29, 54, 77, 104, 145, 172
FblI GTMKAC 1 cut(s) 171
FokI GGATG 3 cut(s) 168, 304, 442
FriOI GRGCYC 1 cut(s) 478
FspBI CTAG 1 cut(s) 353
HaeIII GGCC 1 cut(s) 275
HinfI GANTC 4 cut(s) 326, 349, 397, 484
HphI GGTGA 1 cut(s) 414
Hpy166II GTNNAC 2 cut(s) 122, 172
Hpy188III TCNNGA 5 cut(s) 193, 248, 305, 353, 504
Hpy8I GTNNAC 2 cut(s) 122, 172
HpyCH4III ACNGT 2 cut(s) 126, 169
HpyCH4V TGCA 4 cut(s) 67, 90, 218, 416
HpyF3I CTNAG 1 cut(s) 204
Kzo9I GATC 1 cut(s) 200
LpnPI CCDG 8 cut(s) 130, 171, 198, 206, 261, 387, 414, 489
LweI GCATC 2 cut(s) 54, 425
MaeI CTAG 1 cut(s) 353
MaeIII GTNAC 4 cut(s) 3, 57, 135, 468
MalI GATC 1 cut(s) 202
MboI GATC 1 cut(s) 200
MboII GAAGA 2 cut(s) 164, 411
MfeI CAATTG 2 cut(s) 284, 453
MflI RGATCY 1 cut(s) 200
MhlI GDGCHC 1 cut(s) 478
MluCI AATT 6 cut(s) 21, 72, 284, 378, 453, 498
MlyI GAGTC 2 cut(s) 320, 358
MmeI TCCRAC 3 cut(s) 129, 420, 475
MnlI CCTC 2 cut(s) 301, 344
MspA1I CMGCKG 1 cut(s) 299
MspR9I CCNGG 2 cut(s) 186, 402
MunI CAATTG 2 cut(s) 284, 453
MvaI CCWGG 2 cut(s) 186, 402
NdeII GATC 1 cut(s) 200
NmuCI GTSAC 3 cut(s) 3, 57, 468
PfeI GAWTC 2 cut(s) 397, 484
PfoI TCCNGGA 1 cut(s) 400
PleI GAGTC 2 cut(s) 320, 357
PpsI GAGTC 2 cut(s) 320, 357
PsiI TTATAA 1 cut(s) 77
Psp6I CCWGG 2 cut(s) 184, 400
PspGI CCWGG 2 cut(s) 184, 400
PspPI GGNCC 1 cut(s) 273
PsuI RGATCY 1 cut(s) 200
PvuII CAGCTG 1 cut(s) 299
Sau3AI GATC 1 cut(s) 200
Sau96I GGNCC 1 cut(s) 273
SchI GAGTC 2 cut(s) 320, 358
ScrFI CCNGG 2 cut(s) 186, 402
SduI GDGCHC 1 cut(s) 478
SetI ASST 5 cut(s) 59, 99, 301, 336, 427
SfaNI GCATC 2 cut(s) 54, 425
Sse9I AATT 6 cut(s) 21, 72, 284, 378, 453, 498
SspMI CTAG 1 cut(s) 353
StyD4I CCNGG 2 cut(s) 184, 400
StyI CCWWGG 2 cut(s) 321, 425
TaaI ACNGT 2 cut(s) 126, 169
TasI AATT 6 cut(s) 21, 72, 284, 378, 453, 498
TfiI GAWTC 2 cut(s) 397, 484
TseFI GTSAC 3 cut(s) 3, 57, 468
Tsp45I GTSAC 3 cut(s) 3, 57, 468
TspDTI ATGAA 1 cut(s) 446
XapI RAATTY 1 cut(s) 498
XbaI TCTAGA 1 cut(s) 352
XmiI GTMKAC 1 cut(s) 171
XspI CTAG 1 cut(s) 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.