Prupe.2G209600_v2.0.a1

DVL family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
24246806 .. 24246991
186 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G209600.1

Sequence Viewer

Length: 186 bp
ATGAAGCAAAGCCAAGGGCAGGGCCACGTCAGCAACAGCAACTTCTGTTGCAGGCATGTGAGAGAGCCATGTAGGTCATTTGGGCGCAGATGCAGTATGCTGGTGAAGGAGCAAAGGGCAAGGTTCTATATTCTCAGGCGATGTGTCACTATGCTCCTTTGTTGGCATGAGCGGGGTGACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.3

Weight (kDa)

9.98

Isoelectric Point (pI)

70.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 184
AccBSI CCGCTC 1 cut(s) 172
AciI CCGC 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 19
AjiI CACGTC 1 cut(s) 28
AoxI GGCC 1 cut(s) 22
AspLEI GCGC 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 115
BmgBI CACGTC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 22
BmsI GCATC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 148
BshFI GGCC 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 19
BsnI GGCC 1 cut(s) 24
BspACI CCGC 1 cut(s) 172
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 147
BsrBI CCGCTC 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 13
BssT1I CCWWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 134
BstHHI GCGC 1 cut(s) 87
BstMWI GCNNNNNNNGC 1 cut(s) 30
BstNSI RCATGY 1 cut(s) 59
BsuRI GGCC 1 cut(s) 24
BtgZI GCGATG 1 cut(s) 154
BtrI CACGTC 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 53
CfoI GCGC 1 cut(s) 87
Cfr13I GGNCC 1 cut(s) 22
CviAII CATG 3 cut(s) 56, 69, 167
CviJI RGCY 3 cut(s) 12, 24, 67
CviKI_1 RGCY 3 cut(s) 12, 24, 67
DdeI CTNAG 1 cut(s) 134
Eco130I CCWWGG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
FaeI CATG 3 cut(s) 59, 72, 170
FaiI YATR 7 cut(s) 57, 70, 98, 129, 152, 168, 184
FatI CATG 3 cut(s) 55, 68, 166
FauI CCCGC 1 cut(s) 165
GlaI GCGC 1 cut(s) 86
HaeIII GGCC 1 cut(s) 24
HhaI GCGC 1 cut(s) 87
Hin1II CATG 3 cut(s) 59, 72, 170
Hin6I GCGC 1 cut(s) 85
HinP1I GCGC 1 cut(s) 85
HphI GGTGA 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 2 cut(s) 51, 93
HpyF10VI GCNNNNNNNGC 1 cut(s) 30
HpyF3I CTNAG 1 cut(s) 134
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 3 cut(s) 59, 72, 170
HspAI GCGC 1 cut(s) 85
LmnI GCTCC 2 cut(s) 109, 159
LpnPI CCDG 4 cut(s) 5, 37, 86, 121
LweI GCATC 1 cut(s) 80
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 2 cut(s) 145, 176
MbiI CCGCTC 1 cut(s) 172
MwoI GCNNNNNNNGC 1 cut(s) 30
NlaIII CATG 3 cut(s) 59, 72, 170
NmuCI GTSAC 2 cut(s) 145, 176
NspI RCATGY 1 cut(s) 59
PsiI TTATAA 1 cut(s) 184
PspPI GGNCC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 22
SetI ASST 3 cut(s) 30, 77, 125
SfaNI GCATC 1 cut(s) 80
SsiI CCGC 1 cut(s) 172
StyI CCWWGG 1 cut(s) 13
TaiI ACGT 1 cut(s) 30
TseFI GTSAC 2 cut(s) 145, 176
Tsp45I GTSAC 2 cut(s) 145, 176
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.