Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0018117

Physical Location & Seq

Genomic Coordinates Reverse (-)

13498505 .. 13498747

Gene Structure 243 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G131600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 243 bp

ATGCCATTAAGTTGTAATGTTGTTCATGGAAAATTGTATGCTCATGGGTCGATGAGAGTCGTACCATCAAAGATTTATCTTTATGGTATGGTTGAATGTAAAAATGACCTTTCAGGCGTAGATTGTAAGAAGTGTATTGATGTTGCAAGAAGTGAACTTTTGGGTCATTCTTATAAAATGAAAGTTGGTCGTGCTATTTATGGGAGTTGTAATAATAGAAATATTACCCCTTTCACTACGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0008150 GO:0009719 GO:0009725 GO:0009737 GO:0010033 GO:0030312 GO:0033993 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0050896 GO:0071944 GO:0097305 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1204 Stress-antifung

Protein Analysis

81

Amino Acids

8.87

Weight (kDa)

9.25

Isoelectric Point (pI)

44.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018117)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G571900_v2.0.a1 Prupe.2G027800_v2.0.a1 Prupe.3G131600_v2.0.a1 Prupe.4G264700_v2.0.a1 Prupe.5G040500_v2.0.a1 Prupe.6G115000_v2.0.a1 Prupe.6G146300_v2.0.a1 Prupe.7G024300_v2.0.a1 Prupe.8G113500_v2.0.a1
rosa_samantha	Rh2CG587300 Rh2DG629600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	174
AfaI	GTAC	1 cut(s)	63
AgsI	TTSAA	1 cut(s)	95
BccI	CCATC	1 cut(s)	73
BsaAI	YACGTR	1 cut(s)	240
BstBAI	YACGTR	1 cut(s)	240
BstSNI	TACGTA	1 cut(s)	240
Csp6I	GTAC	1 cut(s)	62
CviAII	CATG	2 cut(s)	26, 44
CviQI	GTAC	1 cut(s)	62
Eco105I	TACGTA	1 cut(s)	240
FaeI	CATG	2 cut(s)	29, 47
FaiI	YATR	7 cut(s)	27, 39, 45, 84, 89, 174, 201
FatI	CATG	2 cut(s)	25, 43
Hin1II	CATG	2 cut(s)	29, 47
HinfI	GANTC	1 cut(s)	57
Hpy166II	GTNNAC	1 cut(s)	155
Hpy8I	GTNNAC	1 cut(s)	155
HpyCH4IV	ACGT	1 cut(s)	239
HpyCH4V	TGCA	1 cut(s)	146
HpySE526I	ACGT	1 cut(s)	239
Hsp92II	CATG	2 cut(s)	29, 47
LpnPI	CCDG	1 cut(s)	99
MaeII	ACGT	1 cut(s)	239
MluCI	AATT	1 cut(s)	32
MlyI	GAGTC	1 cut(s)	66
MseI	TTAA	1 cut(s)	8
NlaIII	CATG	2 cut(s)	29, 47
PleI	GAGTC	1 cut(s)	65
PpsI	GAGTC	1 cut(s)	65
Ppu21I	YACGTR	1 cut(s)	240
PsiI	TTATAA	1 cut(s)	174
RsaI	GTAC	1 cut(s)	63
RsaNI	GTAC	1 cut(s)	62
SaqAI	TTAA	1 cut(s)	8
SchI	GAGTC	1 cut(s)	66
SetI	ASST	2 cut(s)	111, 242
SgeI	CNNG	5 cut(s)	38, 56, 126, 159, 203
SnaBI	TACGTA	1 cut(s)	240
Sse9I	AATT	1 cut(s)	32
SspI	AATATT	1 cut(s)	223
TaiI	ACGT	1 cut(s)	242
TaqI	TCGA	1 cut(s)	50
TasI	AATT	1 cut(s)	32
Tru1I	TTAA	1 cut(s)	8
Tru9I	TTAA	1 cut(s)	8
TspDTI	ATGAA	2 cut(s)	14, 194

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.