Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0018117

Physical Location & Seq

Genomic Coordinates Forward (+)

19597316 .. 19597621

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G264700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

ATGAGTTCAAAAGTTGTTAATAATCCCAAGTTGATTCAGGATAAAGTTCATGCGTTGCTCACCCGCTTAAGTTTTAAAGCTATTAATGGACCGTTGTACGCTAATGGCAAGATAAAAATATCACCAAAAGGGAAAAATGTTTTTGGTACCGTTGAATGTACTAAGGACCTTTCTGAAGTAAATTGTAAGGAGTGTCTTGATGTTGCAATAACTGAACTTCAAGATCGTAGTTATGGAATGAGAGGTGGACATGTTTTTTATGGCAGTTGTTACATAAGATTTGAATTTCATCGATTTTACTATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0008150 GO:0009719 GO:0009725 GO:0009737 GO:0010033 GO:0030312 GO:0033993 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0050896 GO:0071944 GO:0097305 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1204 Stress-antifung

Protein Analysis

102

Amino Acids

11.5

Weight (kDa)

9.25

Isoelectric Point (pI)

45.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018117)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G571900_v2.0.a1 Prupe.2G027800_v2.0.a1 Prupe.3G131600_v2.0.a1 Prupe.4G264700_v2.0.a1 Prupe.5G040500_v2.0.a1 Prupe.6G115000_v2.0.a1 Prupe.6G146300_v2.0.a1 Prupe.7G024300_v2.0.a1 Prupe.8G113500_v2.0.a1
rosa_samantha	Rh2CG587300 Rh2DG629600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	146
AccB1I	GGYRCC	1 cut(s)	146
AciI	CCGC	1 cut(s)	64
AcsI	RAATTY	1 cut(s)	284
AcuI	CTGAAG	1 cut(s)	195
AfaI	GTAC	3 cut(s)	98, 148, 160
AflII	CTTAAG	1 cut(s)	67
AflIII	ACRYGT	1 cut(s)	250
AgsI	TTSAA	4 cut(s)	9, 155, 221, 284
AluBI	AGCT	1 cut(s)	80
AluI	AGCT	1 cut(s)	80
ApoI	RAATTY	1 cut(s)	284
AseI	ATTAAT	1 cut(s)	84
Asp718I	GGTACC	1 cut(s)	146
AspS9I	GGNCC	2 cut(s)	89, 166
AsuHPI	GGTGA	2 cut(s)	52, 114
AvaII	GGWCC	2 cut(s)	89, 166
BanI	GGYRCC	1 cut(s)	146
BfrI	CTTAAG	1 cut(s)	67
Bme18I	GGWCC	2 cut(s)	89, 166
BmgT120I	GGNCC	2 cut(s)	89, 166
BmiI	GGNNCC	1 cut(s)	148
Bsa29I	ATCGAT	1 cut(s)	292
BseCI	ATCGAT	1 cut(s)	292
BshNI	GGYRCC	1 cut(s)	146
BshVI	ATCGAT	1 cut(s)	292
Bsp143I	GATC	1 cut(s)	223
BspACI	CCGC	1 cut(s)	64
BspDI	ATCGAT	1 cut(s)	292
BspLI	GGNNCC	1 cut(s)	148
BspT107I	GGYRCC	1 cut(s)	146
BspTI	CTTAAG	1 cut(s)	67
BssMI	GATC	1 cut(s)	223
Bst4CI	ACNGT	2 cut(s)	93, 151
BstAFI	CTTAAG	1 cut(s)	67
BstDEI	CTNAG	1 cut(s)	162
BstKTI	GATC	1 cut(s)	226
BstMBI	GATC	1 cut(s)	223
BstNSI	RCATGY	1 cut(s)	254
Bsu15I	ATCGAT	1 cut(s)	292
BsuTUI	ATCGAT	1 cut(s)	292
Cfr13I	GGNCC	2 cut(s)	89, 166
ClaI	ATCGAT	1 cut(s)	292
Csp6I	GTAC	3 cut(s)	97, 147, 159
CviAII	CATG	2 cut(s)	50, 251
CviJI	RGCY	1 cut(s)	80
CviKI_1	RGCY	1 cut(s)	80
CviQI	GTAC	3 cut(s)	97, 147, 159
DdeI	CTNAG	1 cut(s)	162
DpnI	GATC	1 cut(s)	225
DpnII	GATC	1 cut(s)	223
DraI	TTTAAA	1 cut(s)	76
Eco47I	GGWCC	2 cut(s)	89, 166
Eco57I	CTGAAG	1 cut(s)	195
EcoO109I	RGGNCCY	1 cut(s)	166
FaeI	CATG	2 cut(s)	53, 254
FaiI	YATR	5 cut(s)	51, 234, 252, 261, 275
FatI	CATG	2 cut(s)	49, 250
FauI	CCCGC	1 cut(s)	71
Hin1II	CATG	2 cut(s)	53, 254
HinfI	GANTC	1 cut(s)	34
HphI	GGTGA	2 cut(s)	52, 114
Hpy166II	GTNNAC	1 cut(s)	248
Hpy188I	TCNGA	1 cut(s)	175
Hpy188III	TCNNGA	3 cut(s)	38, 197, 221
Hpy8I	GTNNAC	1 cut(s)	248
HpyCH4III	ACNGT	2 cut(s)	93, 151
HpyCH4V	TGCA	1 cut(s)	206
HpyF3I	CTNAG	1 cut(s)	162
Hsp92II	CATG	2 cut(s)	53, 254
KpnI	GGTACC	1 cut(s)	150
Kzo9I	GATC	1 cut(s)	223
LpnPI	CCDG	1 cut(s)	23
MaeIII	GTNAC	1 cut(s)	269
MalI	GATC	1 cut(s)	225
MboI	GATC	1 cut(s)	223
MluCI	AATT	2 cut(s)	181, 284
MnlI	CCTC	1 cut(s)	236
MseI	TTAA	5 cut(s)	18, 68, 75, 84, 304
MspCI	CTTAAG	1 cut(s)	67
NdeII	GATC	1 cut(s)	223
NlaIII	CATG	2 cut(s)	53, 254
NlaIV	GGNNCC	1 cut(s)	148
NspI	RCATGY	1 cut(s)	254
PciI	ACATGT	1 cut(s)	250
PfeI	GAWTC	1 cut(s)	34
PpuMI	RGGWCCY	1 cut(s)	166
PscI	ACATGT	1 cut(s)	250
PshBI	ATTAAT	1 cut(s)	84
Psp5II	RGGWCCY	1 cut(s)	166
PspN4I	GGNNCC	1 cut(s)	148
PspPI	GGNCC	2 cut(s)	89, 166
PspPPI	RGGWCCY	1 cut(s)	166
RsaI	GTAC	3 cut(s)	98, 148, 160
RsaNI	GTAC	3 cut(s)	97, 147, 159
SaqAI	TTAA	5 cut(s)	18, 68, 75, 84, 304
Sau3AI	GATC	1 cut(s)	223
Sau96I	GGNCC	2 cut(s)	89, 166
SetI	ASST	3 cut(s)	82, 171, 247
SgeI	CNNG	8 cut(s)	40, 50, 62, 75, 121, 209, 233, 263
SinI	GGWCC	2 cut(s)	89, 166
SmlI	CTYRAG	1 cut(s)	67
SmoI	CTYRAG	1 cut(s)	67
Sse9I	AATT	2 cut(s)	181, 284
SsiI	CCGC	1 cut(s)	64
TaaI	ACNGT	2 cut(s)	93, 151
TaqI	TCGA	1 cut(s)	292
TasI	AATT	2 cut(s)	181, 284
TatI	WGTACW	1 cut(s)	158
TfiI	GAWTC	1 cut(s)	34
Tru1I	TTAA	5 cut(s)	18, 68, 75, 84, 304
Tru9I	TTAA	5 cut(s)	18, 68, 75, 84, 304
TspDTI	ATGAA	2 cut(s)	38, 278
Vha464I	CTTAAG	1 cut(s)	67
VpaK11BI	GGWCC	2 cut(s)	89, 166
VspI	ATTAAT	1 cut(s)	84
XapI	RAATTY	1 cut(s)	284
XceI	RCATGY	1 cut(s)	254

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.