Prupe.5G236200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
17881533 .. 17882701
1169 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G236200.1

Sequence Viewer

Length: 210 bp
ATGGAGAACAGGAACAGCAACAACAACAACAGACAGAGGGAAGGCTTTGAGGAAATGGGTTTTCCTGTTCACAGTCAAGTGAGAAAGATCAAGCAAGAATCCGAGAAAATAATTGATTGGCTGCCGGGAAAGCCAGAGATGAGACCTGTCCTTGGAGAGATCACCATGACCAGGCAGATCTCTCGATCCCCTTTGGGAATTTCTTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.03

Weight (kDa)

9.1

Isoelectric Point (pI)

66.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 180
AcsI RAATTY 1 cut(s) 198
AfiI CCNNNNNNNGG 2 cut(s) 152, 171
AjnI CCWGG 1 cut(s) 170
Alw26I GTCTC 1 cut(s) 136
AlwI GGATC 1 cut(s) 180
ApeKI GCWGC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 198
AsuC2I CCSGG 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 154
BbvI GCAGC 1 cut(s) 108
BcgI CGANNNNNNTGC 2 cut(s) 164, 198
BciT130I CCWGG 1 cut(s) 172
BcnI CCSGG 1 cut(s) 126
BcoDI GTCTC 1 cut(s) 136
BglII AGATCT 1 cut(s) 177
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 126, 172
BmrFI CCNGG 2 cut(s) 126, 172
BpuMI CCSGG 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 2 cut(s) 152, 171
BseBI CCWGG 1 cut(s) 172
BseDI CCNNGG 1 cut(s) 151
BseLI CCNNNNNNNGG 2 cut(s) 152, 171
BseXI GCAGC 1 cut(s) 108
BsiSI CCGG 1 cut(s) 125
BslI CCNNNNNNNGG 2 cut(s) 152, 171
BsmAI GTCTC 1 cut(s) 136
Bso31I GGTCTC 1 cut(s) 136
Bsp143I GATC 4 cut(s) 87, 159, 177, 185
BspPI GGATC 1 cut(s) 180
BspTNI GGTCTC 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 4 cut(s) 87, 159, 177, 185
BssT1I CCWWGG 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 74
BstKTI GATC 4 cut(s) 90, 162, 180, 188
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 4 cut(s) 87, 159, 177, 185
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 172
BstSCI CCNGG 2 cut(s) 124, 170
BstV1I GCAGC 1 cut(s) 108
BstX2I RGATCY 1 cut(s) 177
BstYI RGATCY 1 cut(s) 177
CviAII CATG 1 cut(s) 166
CviJI RGCY 3 cut(s) 45, 121, 133
CviKI_1 RGCY 3 cut(s) 45, 121, 133
DpnI GATC 4 cut(s) 89, 161, 179, 187
DpnII GATC 4 cut(s) 87, 159, 177, 185
Eco130I CCWWGG 1 cut(s) 151
Eco31I GGTCTC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 170
EcoT14I CCWWGG 1 cut(s) 151
ErhI CCWWGG 1 cut(s) 151
FaeI CATG 1 cut(s) 169
FaiI YATR 1 cut(s) 167
FatI CATG 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 122
HapII CCGG 1 cut(s) 125
Hin1II CATG 1 cut(s) 169
HinfI GANTC 1 cut(s) 98
HpaII CCGG 1 cut(s) 125
HphI GGTGA 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 183
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 4 cut(s) 87, 159, 177, 185
LpnPI CCDG 6 cut(s) 78, 138, 147, 157, 159, 184
Lsp1109I GCAGC 1 cut(s) 108
MalI GATC 4 cut(s) 89, 161, 179, 187
MboI GATC 4 cut(s) 87, 159, 177, 185
MflI RGATCY 1 cut(s) 177
MluCI AATT 2 cut(s) 111, 198
MnlI CCTC 2 cut(s) 30, 43
MspI CCGG 1 cut(s) 125
MspR9I CCNGG 2 cut(s) 126, 172
MvaI CCWGG 1 cut(s) 172
MwoI GCNNNNNNNGC 1 cut(s) 130
NciI CCSGG 1 cut(s) 126
NdeII GATC 4 cut(s) 87, 159, 177, 185
NlaIII CATG 1 cut(s) 169
PfeI GAWTC 1 cut(s) 98
PkrI GCNGC 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 170
PspGI CCWGG 1 cut(s) 170
PsuI RGATCY 1 cut(s) 177
SatI GCNGC 1 cut(s) 122
Sau3AI GATC 4 cut(s) 87, 159, 177, 185
ScrFI CCNGG 2 cut(s) 126, 172
SetI ASST 1 cut(s) 148
Sse9I AATT 2 cut(s) 111, 198
StyD4I CCNGG 2 cut(s) 124, 170
StyI CCWWGG 1 cut(s) 151
TaaI ACNGT 1 cut(s) 74
TaqI TCGA 1 cut(s) 184
TasI AATT 2 cut(s) 111, 198
TfiI GAWTC 1 cut(s) 98
TseI GCWGC 1 cut(s) 121
XapI RAATTY 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.