Prupe.6G148000_v2.0.a1
MYB Family

At2g29880-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0018272
Physical Location & Seq
Forward (+)
12425295 .. 12425528
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G148000.1

Sequence Viewer

Length: 234 bp
ATGGGGGATTCACAACAAGGAAATAACAAAGGAAAGGGCAAAGAGAAAGAGAACTATGAATCTTGGACCATGGACGATACCAATGAGTTGTTGCATCTCTTGGTGGATGCTATCAATAGTGGTTTGCGCGATGTTAATGGGTCACTTAGCAAGAAAAATGTAAAAAGAGTGATACTATCTCGTCTTAATGCGAAAATTACGTTCCCTAAAACTTATAATCATTACTTGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

78

Amino Acids

8.72

Weight (kDa)

9.3

Isoelectric Point (pI)

26.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 216
AccII CGCG 1 cut(s) 129
AluBI AGCT 1 cut(s) 231
AluI AGCT 1 cut(s) 231
AspLEI GCGC 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 66
AvaII GGWCC 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 66
BmsI GCATC 2 cut(s) 97, 103
BsaJI CCNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 112
Bsh1236I CGCG 1 cut(s) 129
Bsp19I CCATGG 1 cut(s) 69
BspFNI CGCG 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 146
BstDSI CCRYGG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 112
BstFNI CGCG 1 cut(s) 129
BstHHI GCGC 1 cut(s) 129
BstUI CGCG 1 cut(s) 129
BtgI CCRYGG 1 cut(s) 69
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 1 cut(s) 112
CfoI GCGC 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 66
CviAII CATG 1 cut(s) 70
CviJI RGCY 1 cut(s) 231
CviKI_1 RGCY 1 cut(s) 231
DdeI CTNAG 1 cut(s) 146
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 66
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 1 cut(s) 73
FaiI YATR 3 cut(s) 57, 71, 216
FatI CATG 1 cut(s) 69
FokI GGATG 1 cut(s) 119
GlaI GCGC 1 cut(s) 128
HhaI GCGC 1 cut(s) 129
Hin1II CATG 1 cut(s) 73
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
HinfI GANTC 2 cut(s) 8, 59
HpyCH4IV ACGT 1 cut(s) 200
HpyCH4V TGCA 1 cut(s) 94
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 200
Hsp92II CATG 1 cut(s) 73
HspAI GCGC 1 cut(s) 127
LweI GCATC 2 cut(s) 97, 103
MaeII ACGT 1 cut(s) 200
MaeIII GTNAC 1 cut(s) 141
MluCI AATT 1 cut(s) 195
MseI TTAA 2 cut(s) 135, 186
MvnI CGCG 1 cut(s) 129
NcoI CCATGG 1 cut(s) 69
NlaIII CATG 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 141
PfeI GAWTC 2 cut(s) 8, 59
PsiI TTATAA 1 cut(s) 216
PspPI GGNCC 1 cut(s) 66
SaqAI TTAA 2 cut(s) 135, 186
Sau96I GGNCC 1 cut(s) 66
SetI ASST 2 cut(s) 203, 233
SfaNI GCATC 2 cut(s) 97, 103
SgeI CNNG 7 cut(s) 29, 75, 82, 112, 140, 163, 192
SinI GGWCC 1 cut(s) 66
SmlI CTYRAG 1 cut(s) 226
SmoI CTYRAG 1 cut(s) 226
Sse9I AATT 1 cut(s) 195
StyI CCWWGG 1 cut(s) 69
TaiI ACGT 1 cut(s) 203
TasI AATT 1 cut(s) 195
TfiI GAWTC 2 cut(s) 8, 59
Tru1I TTAA 2 cut(s) 135, 186
Tru9I TTAA 2 cut(s) 135, 186
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.