Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0014626

Physical Location & Seq

Genomic Coordinates Reverse (-)

21459369 .. 21461207

Gene Structure 1839 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G256100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

ATGACAACTCCATCTCTAGCAGTCTCTCTTCTTCTTTTGTCCCTCCTCCTTTCTGGGGCTCAAGGGATTCGATTGGAGAAAGGATTCATCTCTGTTGCACAACAGAAAAATAATAATAATTTACAAGAACAGGAAACTGCTTCAATGAAAAGAAGTGCTGGTCCAGGAGAGTTCAACAGTCTCTGCAAAGATGGTGGAGAGTGTTCATCATCAGGAAAGACTAGAAAACTAGTCTCTAAGACAGCCTCTAGTGCTGCTACCACAACCACTAACACCCCTTCAAAGAATGACAAGGATGATGGAGGGAACAGAGGTGACCTGGACCCAAAAGGTGAAAAGGTTAATAATAATACACAGCCTGGTGGGGAAGATGGTGATGCGAAAGCTAAGTCATCATCGGTTATTTCAAAGCACCAGGAGCAGGAGGCTGCAGTAGCCCACCAAGTCCAACACTATCCTGACCTCACAGACATGACTGAAATGGACTATTCTCCAGCAAGGAGAAAACCTCCGATACACAACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

175

Amino Acids

18.5

Weight (kDa)

6.91

Isoelectric Point (pI)

42.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014626)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g01840
malus_domestica	MD02G1016300.v1.1 MD15G1160900.v1.1
prunus_persica	Prupe.7G256100_v2.0.a1
pyrus_communis	pycom02g01450 pycom15g14480
rosa_chinensis	RchiOBHm_Chr2g0086811
rosa_laevigata	RLG00000015798
rosa_multiflora	Rmu_sc0025147.1_g000001 Rmu_sc0027662.1_g000001
rosa_roxburghii	Rroxscaffold_2G00154140
rosa_rugosa	Rorug01G0469700.1
rosa_samantha	Rh2AG022400 Rh2BG022700 Rh2CG023300 Rh2DG022900
rosa_wichuraiana	Rw2G001780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	2 cut(s)	55, 421
AgsI	TTSAA	4 cut(s)	144, 175, 282, 408
AhlI	ACTAGT	1 cut(s)	229
AjnI	CCWGG	4 cut(s)	163, 318, 358, 414
AluBI	AGCT	1 cut(s)	386
AluI	AGCT	1 cut(s)	386
Alw26I	GTCTC	3 cut(s)	28, 185, 238
AlwNI	CAGNNNCTG	1 cut(s)	183
ApeKI	GCWGC	2 cut(s)	254, 428
ArsI	GACNNNNNNTTYG	2 cut(s)	374, 406
Asp700I	GAANNNNTTC	1 cut(s)	83
AspS9I	GGNCC	2 cut(s)	161, 322
AsuHPI	GGTGA	3 cut(s)	326, 344, 386
AvaII	GGWCC	2 cut(s)	161, 322
BanII	GRGCYC	1 cut(s)	61
BbvI	GCAGC	2 cut(s)	241, 415
BccI	CCATC	4 cut(s)	19, 185, 293, 365
BciT130I	CCWGG	4 cut(s)	165, 320, 360, 416
BcoDI	GTCTC	3 cut(s)	28, 185, 238
BcuI	ACTAGT	1 cut(s)	229
BfaI	CTAG	4 cut(s)	17, 222, 230, 249
BfmI	CTRYAG	1 cut(s)	429
BisI	GCNGC	2 cut(s)	255, 429
BlsI	GCNGC	2 cut(s)	256, 430
Bme1390I	CCNGG	4 cut(s)	165, 320, 360, 416
Bme18I	GGWCC	2 cut(s)	161, 322
BmgT120I	GGNCC	2 cut(s)	161, 322
BmiI	GGNNCC	1 cut(s)	324
BmrFI	CCNGG	4 cut(s)	165, 320, 360, 416
BmsI	GCATC	1 cut(s)	367
BplI	GAGNNNNNCTC	2 cut(s)	493, 525
BpmI	CTGGAG	1 cut(s)	477
BpuEI	CTTGAG	1 cut(s)	45
Bsc4I	CCNNNNNNNGG	2 cut(s)	55, 421
BseBI	CCWGG	4 cut(s)	165, 320, 360, 416
BseGI	GGATG	1 cut(s)	301
BseLI	CCNNNNNNNGG	2 cut(s)	55, 421
BseRI	GAGGAG	1 cut(s)	35
BseXI	GCAGC	2 cut(s)	241, 415
BslFI	GGGAC	1 cut(s)	25
BslI	CCNNNNNNNGG	2 cut(s)	55, 421
BsmAI	GTCTC	3 cut(s)	28, 185, 238
BsmFI	GGGAC	1 cut(s)	25
Bsp1286I	GDGCHC	1 cut(s)	61
BspLI	GGNNCC	1 cut(s)	324
BspMAI	CTGCAG	1 cut(s)	433
Bst2UI	CCWGG	4 cut(s)	165, 320, 360, 416
Bst4CI	ACNGT	1 cut(s)	179
Bst6I	CTCTTC	1 cut(s)	33
BstDEI	CTNAG	2 cut(s)	237, 387
BstEII	GGTNACC	1 cut(s)	314
BstF5I	GGATG	1 cut(s)	301
BstMAI	GTCTC	3 cut(s)	28, 185, 238
BstMWI	GCNNNNNNNGC	3 cut(s)	251, 418, 434
BstNI	CCWGG	4 cut(s)	165, 320, 360, 416
BstPI	GGTNACC	1 cut(s)	314
BstSCI	CCNGG	4 cut(s)	163, 318, 358, 414
BstSFI	CTRYAG	1 cut(s)	429
BstV1I	GCAGC	2 cut(s)	241, 415
BtsCI	GGATG	1 cut(s)	301
CaiI	CAGNNNCTG	1 cut(s)	183
Cfr13I	GGNCC	2 cut(s)	161, 322
CspCI	CAANNNNNGTGG	2 cut(s)	175, 210
CviAII	CATG	1 cut(s)	472
CviJI	RGCY	6 cut(s)	59, 245, 358, 386, 428, 437
CviKI_1	RGCY	6 cut(s)	59, 245, 358, 386, 428, 437
DdeI	CTNAG	2 cut(s)	237, 387
Eam1104I	CTCTTC	1 cut(s)	33
EarI	CTCTTC	1 cut(s)	33
Eco24I	GRGCYC	1 cut(s)	61
Eco47I	GGWCC	2 cut(s)	161, 322
Eco91I	GGTNACC	1 cut(s)	314
EcoO65I	GGTNACC	1 cut(s)	314
EcoRII	CCWGG	4 cut(s)	163, 318, 358, 414
EcoT38I	GRGCYC	1 cut(s)	61
FaeI	CATG	1 cut(s)	475
FaiI	YATR	1 cut(s)	473
FaqI	GGGAC	1 cut(s)	25
FatI	CATG	1 cut(s)	471
Fnu4HI	GCNGC	2 cut(s)	255, 429
FokI	GGATG	1 cut(s)	308
FriOI	GRGCYC	1 cut(s)	61
Fsp4HI	GCNGC	2 cut(s)	255, 429
FspBI	CTAG	4 cut(s)	17, 222, 230, 249
GluI	GCNGC	2 cut(s)	255, 429
GsuI	CTGGAG	1 cut(s)	477
Hin1II	CATG	1 cut(s)	475
HinfI	GANTC	2 cut(s)	67, 84
HphI	GGTGA	3 cut(s)	326, 344, 386
Hpy188I	TCNGA	1 cut(s)	513
Hpy188III	TCNNGA	2 cut(s)	213, 458
HpyAV	CCTTC	1 cut(s)	288
HpyCH4III	ACNGT	1 cut(s)	179
HpyCH4V	TGCA	3 cut(s)	98, 186, 431
HpyF10VI	GCNNNNNNNGC	3 cut(s)	251, 418, 434
HpyF3I	CTNAG	2 cut(s)	237, 387
Hsp92II	CATG	1 cut(s)	475
LmnI	GCTCC	1 cut(s)	418
Lsp1109I	GCAGC	2 cut(s)	241, 415
LweI	GCATC	1 cut(s)	367
MaeI	CTAG	4 cut(s)	17, 222, 230, 249
MaeIII	GTNAC	1 cut(s)	314
MboII	GAAGA	3 cut(s)	20, 23, 380
MhlI	GDGCHC	1 cut(s)	61
MluCI	AATT	1 cut(s)	118
MmeI	TCCRAC	1 cut(s)	472
MnlI	CCTC	8 cut(s)	53, 56, 256, 296, 305, 418, 473, 519
MroXI	GAANNNNTTC	1 cut(s)	83
MseI	TTAA	1 cut(s)	342
MslI	CAYNNNNRTG	1 cut(s)	470
MspR9I	CCNGG	4 cut(s)	165, 320, 360, 416
MvaI	CCWGG	4 cut(s)	165, 320, 360, 416
MwoI	GCNNNNNNNGC	3 cut(s)	251, 418, 434
NlaIII	CATG	1 cut(s)	475
NlaIV	GGNNCC	1 cut(s)	324
NmuCI	GTSAC	1 cut(s)	314
PdmI	GAANNNNTTC	1 cut(s)	83
PfeI	GAWTC	2 cut(s)	67, 84
PfoI	TCCNGGA	1 cut(s)	163
PkrI	GCNGC	2 cut(s)	256, 430
Psp6I	CCWGG	4 cut(s)	163, 318, 358, 414
PspEI	GGTNACC	1 cut(s)	314
PspGI	CCWGG	4 cut(s)	163, 318, 358, 414
PspN4I	GGNNCC	1 cut(s)	324
PspPI	GGNCC	2 cut(s)	161, 322
PstI	CTGCAG	1 cut(s)	433
PstNI	CAGNNNCTG	1 cut(s)	183
RseI	CAYNNNNRTG	1 cut(s)	470
SaqAI	TTAA	1 cut(s)	342
SatI	GCNGC	2 cut(s)	255, 429
Sau96I	GGNCC	2 cut(s)	161, 322
ScrFI	CCNGG	4 cut(s)	165, 320, 360, 416
SduI	GDGCHC	1 cut(s)	61
SetI	ASST	7 cut(s)	316, 321, 334, 342, 388, 465, 511
SfaNI	GCATC	1 cut(s)	367
SfcI	CTRYAG	1 cut(s)	429
SinI	GGWCC	2 cut(s)	161, 322
SmiMI	CAYNNNNRTG	1 cut(s)	470
SmlI	CTYRAG	1 cut(s)	60
SmoI	CTYRAG	1 cut(s)	60
SpeI	ACTAGT	1 cut(s)	229
Sse9I	AATT	1 cut(s)	118
SspMI	CTAG	4 cut(s)	17, 222, 230, 249
StyD4I	CCNGG	4 cut(s)	163, 318, 358, 414
TaaI	ACNGT	1 cut(s)	179
TaqI	TCGA	1 cut(s)	70
TasI	AATT	1 cut(s)	118
TfiI	GAWTC	2 cut(s)	67, 84
Tru1I	TTAA	1 cut(s)	342
Tru9I	TTAA	1 cut(s)	342
TseFI	GTSAC	1 cut(s)	314
TseI	GCWGC	2 cut(s)	254, 428
Tsp45I	GTSAC	1 cut(s)	314
TspDTI	ATGAA	3 cut(s)	76, 161, 195
VpaK11BI	GGWCC	2 cut(s)	161, 322
XmnI	GAANNNNTTC	1 cut(s)	83
XspI	CTAG	4 cut(s)	17, 222, 230, 249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.