Prupe.8G056300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0015359
Physical Location & Seq
Forward (+)
6547450 .. 6548471
1022 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G056300.1

Sequence Viewer

Length: 522 bp
ATGGCCACACAAGATTTCAGCTTCCCCACTCACAAATTCCCTTGCACCATCGATTCACCCCCTTTGTGGCGCTTATCTCCTGCAGCCAGCTCCAAAGTAGATGATCAAAATCATAGCGAAGAAGAAGAAGAAGAAGACGACGAAGAAGAGATCGTCAACATCAATGTAAAGTATTGTGATCAGAGAAGAAAGAGCTTTTCGTATATTGAACGCGGCACGAAAATGGTGGAGAAAGATCAAGAGAGTAGGGATCATGATCATGGGGAGGAGAAGATGGACATGCTTTGGGAGGATTTCAACGAAGAATTGAAGTCAAGAAGTAATACGACGTCGGATTATTCTGGTGGGTTGTCAAGAGAGATGCTTCACTTGGGTTGTGTTAAAGCTTTCAAGTTGACCGAAACAAATGGTGATCATGCGCTTTCGACCAGGAAGCCCAGCGTGGTGGCGGTTATGAAGGTCCTGAAAAGGCTGTTCTTCCTCCATAACTCTCATCACAAACTCAAGAAACCTGCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

174

Amino Acids

20.13

Weight (kDa)

5.6

Isoelectric Point (pI)

67.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015359)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G71910 AT1G71910
fragaria_vesca FvH4_4g19940
prunus_persica Prupe.8G056300_v2.0.a1
pyrus_communis pycom05g03380
rosa_chinensis RchiOBHm_Chr6g0272051
rosa_laevigata RLG00000013704
rosa_multiflora Rmu_sc0005786.1_g000006 Rmu_sc0013301.1_g000002
rosa_roxburghii Rroxscaffold_7G00196620
rosa_rugosa Rorug06G0065400
rosa_samantha Rh6AG182700 Rh6BG184500 Rh6CG183800 Rh6DG175400
rosa_wichuraiana Rw6G015720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 332
AccII CGCG 1 cut(s) 213
AciI CCGC 2 cut(s) 213, 449
AclWI GGATC 1 cut(s) 258
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 35
AcyI GRCGYC 1 cut(s) 329
AfiI CCNNNNNNNGG 1 cut(s) 66
AgsI TTSAA 4 cut(s) 209, 298, 310, 391
AjnI CCWGG 1 cut(s) 428
AluBI AGCT 4 cut(s) 21, 90, 195, 386
AluI AGCT 4 cut(s) 21, 90, 195, 386
AlwI GGATC 1 cut(s) 258
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 83
ApoI RAATTY 1 cut(s) 35
AspLEI GCGC 2 cut(s) 72, 421
AspS9I GGNCC 1 cut(s) 460
AsuHPI GGTGA 2 cut(s) 48, 422
AvaII GGWCC 1 cut(s) 460
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 141
BbvI GCAGC 1 cut(s) 95
BccI CCATC 2 cut(s) 56, 268
BciT130I CCWGG 1 cut(s) 430
BclI TGATCA 4 cut(s) 103, 178, 256, 412
BfmI CTRYAG 1 cut(s) 81
BfoI RGCGCY 1 cut(s) 73
BisI GCNGC 2 cut(s) 84, 214
BlsI GCNGC 2 cut(s) 85, 215
Bme1390I CCNGG 1 cut(s) 430
Bme18I GGWCC 1 cut(s) 460
BmgT120I GGNCC 1 cut(s) 460
BmrFI CCNGG 1 cut(s) 430
BmsI GCATC 1 cut(s) 351
BpiI GAAGAC 1 cut(s) 141
BpuEI CTTGAG 1 cut(s) 488
Bsa29I ATCGAT 1 cut(s) 51
BsaBI GATNNNNATC 2 cut(s) 108, 255
BsaHI GRCGYC 1 cut(s) 329
Bsc4I CCNNNNNNNGG 1 cut(s) 66
Bse8I GATNNNNATC 2 cut(s) 108, 255
BseBI CCWGG 1 cut(s) 430
BseCI ATCGAT 1 cut(s) 51
BseJI GATNNNNATC 2 cut(s) 108, 255
BseLI CCNNNNNNNGG 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 281
BseXI GCAGC 1 cut(s) 95
BseYI CCCAGC 1 cut(s) 437
Bsh1236I CGCG 1 cut(s) 213
BshFI GGCC 1 cut(s) 5
BshVI ATCGAT 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 66
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
BspACI CCGC 2 cut(s) 213, 449
BspANI GGCC 1 cut(s) 5
BspDI ATCGAT 1 cut(s) 51
BspFNI CGCG 1 cut(s) 213
BspHI TCATGA 1 cut(s) 253
BspMAI CTGCAG 1 cut(s) 85
BspPI GGATC 1 cut(s) 258
BssMI GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
BssNI GRCGYC 1 cut(s) 329
Bst2UI CCWGG 1 cut(s) 430
Bst6I CTCTTC 1 cut(s) 141
BstACI GRCGYC 1 cut(s) 329
BstC8I GCNNGC 1 cut(s) 88
BstFNI CGCG 1 cut(s) 213
BstH2I RGCGCY 1 cut(s) 73
BstHHI GCGC 2 cut(s) 72, 421
BstKTI GATC 7 cut(s) 106, 153, 181, 238, 253, 259, 415
BstMBI GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
BstNI CCWGG 1 cut(s) 430
BstNSI RCATGY 1 cut(s) 283
BstSCI CCNGG 1 cut(s) 428
BstSFI CTRYAG 1 cut(s) 81
BstUI CGCG 1 cut(s) 213
BstV1I GCAGC 1 cut(s) 95
BstV2I GAAGAC 1 cut(s) 141
BstXI CCANNNNNNTGG 1 cut(s) 445
Bsu15I ATCGAT 1 cut(s) 51
BsuRI GGCC 1 cut(s) 5
BsuTUI ATCGAT 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 88
CciI TCATGA 1 cut(s) 253
CfoI GCGC 2 cut(s) 72, 421
Cfr13I GGNCC 1 cut(s) 460
ClaI ATCGAT 1 cut(s) 51
CviAII CATG 4 cut(s) 254, 260, 280, 416
CviJI RGCY 8 cut(s) 5, 21, 86, 90, 195, 386, 436, 472
CviKI_1 RGCY 8 cut(s) 5, 21, 86, 90, 195, 386, 436, 472
DpnI GATC 7 cut(s) 105, 152, 180, 237, 252, 258, 414
DpnII GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 460
EcoO109I RGGNCCY 1 cut(s) 460
EcoRII CCWGG 1 cut(s) 428
FaeI CATG 4 cut(s) 257, 263, 283, 419
FaiI YATR 8 cut(s) 114, 204, 255, 261, 281, 417, 455, 486
FatI CATG 4 cut(s) 253, 259, 279, 415
FbaI TGATCA 4 cut(s) 103, 178, 256, 412
Fnu4HI GCNGC 2 cut(s) 84, 214
Fsp4HI GCNGC 2 cut(s) 84, 214
GlaI GCGC 2 cut(s) 71, 420
GluI GCNGC 2 cut(s) 84, 214
GsaI CCCAGC 1 cut(s) 441
HaeII RGCGCY 1 cut(s) 73
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 2 cut(s) 72, 421
Hin1I GRCGYC 1 cut(s) 329
Hin1II CATG 4 cut(s) 257, 263, 283, 419
Hin6I GCGC 2 cut(s) 70, 419
HinP1I GCGC 2 cut(s) 70, 419
HincII GTYRAC 2 cut(s) 157, 396
HindII GTYRAC 2 cut(s) 157, 396
HindIII AAGCTT 1 cut(s) 384
HinfI GANTC 1 cut(s) 53
HphI GGTGA 2 cut(s) 48, 422
Hpy166II GTNNAC 2 cut(s) 157, 396
Hpy188I TCNGA 2 cut(s) 183, 334
Hpy188III TCNNGA 6 cut(s) 239, 254, 315, 354, 463, 505
Hpy8I GTNNAC 2 cut(s) 157, 396
Hpy99I CGWCG 3 cut(s) 143, 331, 334
HpyAV CCTTC 1 cut(s) 451
HpyCH4IV ACGT 1 cut(s) 329
HpyCH4V TGCA 2 cut(s) 45, 83
HpySE526I ACGT 1 cut(s) 329
Hsp92I GRCGYC 1 cut(s) 329
Hsp92II CATG 4 cut(s) 257, 263, 283, 419
HspAI GCGC 2 cut(s) 70, 419
Ksp22I TGATCA 4 cut(s) 103, 178, 256, 412
Kzo9I GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 7 cut(s) 93, 100, 327, 415, 442, 451, 476
Lsp1109I GCAGC 1 cut(s) 95
LweI GCATC 1 cut(s) 351
MaeII ACGT 1 cut(s) 329
MalI GATC 7 cut(s) 105, 152, 180, 237, 252, 258, 414
MboI GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 35, 305
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 312
MnlI CCTC 3 cut(s) 259, 283, 491
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 381
MslI CAYNNNNRTG 2 cut(s) 221, 258
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 430
MvaI CCWGG 1 cut(s) 430
MvnI CGCG 1 cut(s) 213
NdeII GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
NlaIII CATG 4 cut(s) 257, 263, 283, 419
NspI RCATGY 1 cut(s) 283
PagI TCATGA 1 cut(s) 253
PfeI GAWTC 1 cut(s) 53
PkrI GCNGC 2 cut(s) 85, 215
PpuMI RGGWCCY 1 cut(s) 460
Psp5II RGGWCCY 1 cut(s) 460
Psp6I CCWGG 1 cut(s) 428
PspFI CCCAGC 1 cut(s) 437
PspGI CCWGG 1 cut(s) 428
PspPI GGNCC 1 cut(s) 460
PspPPI RGGWCCY 1 cut(s) 460
PstI CTGCAG 1 cut(s) 85
RseI CAYNNNNRTG 2 cut(s) 221, 258
SaqAI TTAA 1 cut(s) 381
SatI GCNGC 2 cut(s) 84, 214
Sau3AI GATC 7 cut(s) 103, 150, 178, 235, 250, 256, 412
Sau96I GGNCC 1 cut(s) 460
ScrFI CCNGG 1 cut(s) 430
SetI ASST 7 cut(s) 23, 92, 197, 332, 388, 462, 514
SfaNI GCATC 1 cut(s) 351
SfcI CTRYAG 1 cut(s) 81
SinI GGWCC 1 cut(s) 460
SmiMI CAYNNNNRTG 2 cut(s) 221, 258
SmlI CTYRAG 1 cut(s) 503
SmoI CTYRAG 1 cut(s) 503
Sse9I AATT 2 cut(s) 35, 305
SsiI CCGC 2 cut(s) 213, 449
StyD4I CCNGG 1 cut(s) 428
TaiI ACGT 1 cut(s) 332
TaqI TCGA 2 cut(s) 51, 425
TaqII GACCGA 1 cut(s) 413
TasI AATT 2 cut(s) 35, 305
TauI GCSGC 1 cut(s) 216
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 381
Tru9I TTAA 1 cut(s) 381
TseI GCWGC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 470
VpaK11BI GGWCC 1 cut(s) 460
XapI RAATTY 1 cut(s) 35
XceI RCATGY 1 cut(s) 283
ZraI GACGTC 1 cut(s) 330
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.