Rroxscaffold_7G00196620

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0015359
Physical Location & Seq
Forward (+)
39652486 .. 39653967
1482 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00196620.1

Sequence Viewer

Length: 642 bp
ATGGCCACAGATGATTTCAGCTTCCCCACAGTACACAAAAGCAGTAGTACTAGTAACATCCATTTCCCTCCTCTGTGGCGGCCATCTCCGGCAGCCGCCTGCACAGATGATGAAGAAGATCACGCAGCCCTAAAAACTAGTCCTGTGGAGAATATCGAGGGGGTTGATGATGATCAGATAATAGTTAGTAGTGATGTTCAAGATCAGGAGCAGAAAATGGACATGCTGTGGGAGGATTTCAATGAGGAATTGTATCCGGTAAGGTCAACGTCGGATTACAGTTACGCGTCCAGCGAGATGCTGCAACTGGGTTGTGTAGGTCTTGGTGCTTTCAACTTGTCCAAATCTAATGCTGCTAGAAATAGTAGTACTATTACAAACCCAGGTGTGGTCGTGATTGTCAAACTCTTGAAAAGGCTATTCTTCCTCCATAATTCTCATCATCACAACCTCAACAAATCTGCAAAACGAGCCATTCCTGCTTACAAGCTGAGTCAGGTCGACACAACTTCCATCGCAAAATCTAATTTACCACCTCAGCAGCCTGTGAAGATTAAGGTCCTTATCCATAACGAAACAACCATTATTCTTATTATTCATTCATTGTTGAGGAGCGGTAATTGCTACAGTTGGTTTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

213

Amino Acids

23.71

Weight (kDa)

5.81

Isoelectric Point (pI)

65.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015359)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G71910 AT1G71910
fragaria_vesca FvH4_4g19940
prunus_persica Prupe.8G056300_v2.0.a1
pyrus_communis pycom05g03380
rosa_chinensis RchiOBHm_Chr6g0272051
rosa_laevigata RLG00000013704
rosa_multiflora Rmu_sc0005786.1_g000006 Rmu_sc0013301.1_g000002
rosa_roxburghii Rroxscaffold_7G00196620
rosa_rugosa Rorug06G0065400
rosa_samantha Rh6AG182700 Rh6BG184500 Rh6CG183800 Rh6DG175400
rosa_wichuraiana Rw6G015720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 615
AccI GTMKAC 1 cut(s) 501
AccII CGCG 1 cut(s) 287
AciI CCGC 3 cut(s) 79, 96, 615
AcoI YGGCCR 2 cut(s) 3, 80
AfaI GTAC 3 cut(s) 33, 49, 370
AfiI CCNNNNNNNGG 1 cut(s) 388
AflIII ACRYGT 1 cut(s) 285
AgsI TTSAA 4 cut(s) 200, 241, 334, 412
AhlI ACTAGT 2 cut(s) 50, 137
AjnI CCWGG 1 cut(s) 382
AluBI AGCT 2 cut(s) 21, 490
AluI AGCT 2 cut(s) 21, 490
AoxI GGCC 2 cut(s) 3, 80
ApeKI GCWGC 5 cut(s) 92, 125, 301, 353, 541
AspS9I GGNCC 1 cut(s) 559
AvaII GGWCC 1 cut(s) 559
BalI TGGCCA 1 cut(s) 5
BbvCI CCTCAGC 1 cut(s) 537
BbvI GCAGC 5 cut(s) 104, 137, 288, 340, 553
BccI CCATC 2 cut(s) 91, 521
BciT130I CCWGG 1 cut(s) 384
BciVI GTATCC 1 cut(s) 264
BclI TGATCA 1 cut(s) 172
BcuI ACTAGT 2 cut(s) 50, 137
BfaI CTAG 3 cut(s) 51, 138, 357
BfmI CTRYAG 1 cut(s) 625
BfuI GTATCC 1 cut(s) 264
BisI GCNGC 7 cut(s) 80, 93, 96, 126, 302, 354, 542
BlsI GCNGC 7 cut(s) 81, 94, 97, 127, 303, 355, 543
BmcAI AGTACT 2 cut(s) 49, 370
Bme1390I CCNGG 1 cut(s) 384
Bme18I GGWCC 1 cut(s) 559
BmgT120I GGNCC 1 cut(s) 559
BmrFI CCNGG 1 cut(s) 384
BmrI ACTGGG 1 cut(s) 317
BmsI GCATC 1 cut(s) 288
BmuI ACTGGG 1 cut(s) 317
Bpu10I CCTNAGC 1 cut(s) 537
BsaBI GATNNNNATC 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 382
BsaWI WCCGGW 1 cut(s) 256
Bsc4I CCNNNNNNNGG 1 cut(s) 388
Bse1I ACTGG 1 cut(s) 312
Bse8I GATNNNNATC 1 cut(s) 171
BseBI CCWGG 1 cut(s) 384
BseDI CCNNGG 1 cut(s) 382
BseGI GGATG 1 cut(s) 57
BseJI GATNNNNATC 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 388
BseMII CTCAG 2 cut(s) 482, 551
BseNI ACTGG 1 cut(s) 312
BseRI GAGGAG 2 cut(s) 60, 625
BseXI GCAGC 5 cut(s) 104, 137, 288, 340, 553
BsgI GTGCAG 1 cut(s) 85
Bsh1236I CGCG 1 cut(s) 287
BshFI GGCC 2 cut(s) 5, 82
BsiSI CCGG 2 cut(s) 89, 257
BslI CCNNNNNNNGG 1 cut(s) 388
BsnI GGCC 2 cut(s) 5, 82
Bsp143I GATC 3 cut(s) 118, 172, 202
BspACI CCGC 3 cut(s) 79, 96, 615
BspANI GGCC 2 cut(s) 5, 82
BspCNI CTCAG 2 cut(s) 483, 550
BspFNI CGCG 1 cut(s) 287
BsrBI CCGCTC 1 cut(s) 615
BsrI ACTGG 1 cut(s) 312
BssECI CCNNGG 1 cut(s) 382
BssMI GATC 3 cut(s) 118, 172, 202
Bst2UI CCWGG 1 cut(s) 384
Bst4CI ACNGT 3 cut(s) 31, 281, 629
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 2 cut(s) 491, 537
BstF5I GGATG 1 cut(s) 57
BstFNI CGCG 1 cut(s) 287
BstKTI GATC 3 cut(s) 121, 175, 205
BstMBI GATC 3 cut(s) 118, 172, 202
BstMWI GCNNNNNNNGC 3 cut(s) 470, 479, 621
BstNI CCWGG 1 cut(s) 384
BstNSI RCATGY 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 382
BstSFI CTRYAG 1 cut(s) 625
BstUI CGCG 1 cut(s) 287
BstV1I GCAGC 5 cut(s) 104, 137, 288, 340, 553
BsuI GTATCC 1 cut(s) 264
BsuRI GGCC 2 cut(s) 5, 82
BtgZI GCGATG 1 cut(s) 499
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 100
Cfr13I GGNCC 1 cut(s) 559
CseI GACGC 1 cut(s) 276
Csp6I GTAC 3 cut(s) 32, 48, 369
CviAII CATG 1 cut(s) 223
CviJI RGCY 9 cut(s) 5, 21, 82, 95, 128, 418, 473, 490, 544
CviKI_1 RGCY 9 cut(s) 5, 21, 82, 95, 128, 418, 473, 490, 544
CviQI GTAC 3 cut(s) 32, 48, 369
DdeI CTNAG 2 cut(s) 491, 537
DpnI GATC 3 cut(s) 120, 174, 204
DpnII GATC 3 cut(s) 118, 172, 202
EaeI YGGCCR 2 cut(s) 3, 80
Eco47I GGWCC 1 cut(s) 559
EcoO109I RGGNCCY 1 cut(s) 559
EcoRII CCWGG 1 cut(s) 382
FaeI CATG 1 cut(s) 226
FaiI YATR 3 cut(s) 224, 432, 570
FatI CATG 1 cut(s) 222
FbaI TGATCA 1 cut(s) 172
FblI GTMKAC 1 cut(s) 501
Fnu4HI GCNGC 7 cut(s) 80, 93, 96, 126, 302, 354, 542
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 7 cut(s) 80, 93, 96, 126, 302, 354, 542
FspBI CTAG 3 cut(s) 51, 138, 357
GluI GCNGC 7 cut(s) 80, 93, 96, 126, 302, 354, 542
HaeIII GGCC 2 cut(s) 5, 82
HapII CCGG 2 cut(s) 89, 257
HgaI GACGC 1 cut(s) 276
Hin1II CATG 1 cut(s) 226
HincII GTYRAC 2 cut(s) 267, 502
HindII GTYRAC 2 cut(s) 267, 502
HinfI GANTC 1 cut(s) 493
HpaII CCGG 2 cut(s) 89, 257
Hpy166II GTNNAC 3 cut(s) 34, 267, 502
Hpy188I TCNGA 2 cut(s) 177, 274
Hpy188III TCNNGA 4 cut(s) 200, 206, 394, 409
Hpy8I GTNNAC 3 cut(s) 34, 267, 502
Hpy99I CGWCG 1 cut(s) 274
HpyCH4III ACNGT 3 cut(s) 31, 281, 629
HpyCH4IV ACGT 1 cut(s) 269
HpyCH4V TGCA 3 cut(s) 102, 304, 464
HpyF10VI GCNNNNNNNGC 3 cut(s) 470, 479, 621
HpyF3I CTNAG 2 cut(s) 491, 537
HpySE526I ACGT 1 cut(s) 269
Hsp92II CATG 1 cut(s) 226
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 3 cut(s) 118, 172, 202
LmnI GCTCC 2 cut(s) 208, 612
Lsp1109I GCAGC 5 cut(s) 104, 137, 288, 340, 553
LweI GCATC 1 cut(s) 288
MaeI CTAG 3 cut(s) 51, 138, 357
MaeII ACGT 1 cut(s) 269
MaeIII GTNAC 2 cut(s) 53, 281
MalI GATC 3 cut(s) 120, 174, 204
MbiI CCGCTC 1 cut(s) 615
MboI GATC 3 cut(s) 118, 172, 202
MboII GAAGA 4 cut(s) 125, 128, 415, 562
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 4 cut(s) 248, 433, 526, 619
MluI ACGCGT 1 cut(s) 285
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 502
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 9 cut(s) 78, 81, 151, 226, 238, 437, 461, 546, 603
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 555
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 89, 257
MspR9I CCNGG 1 cut(s) 384
MvaI CCWGG 1 cut(s) 384
MvnI CGCG 1 cut(s) 287
MwoI GCNNNNNNNGC 3 cut(s) 470, 479, 621
NdeII GATC 3 cut(s) 118, 172, 202
NlaIII CATG 1 cut(s) 226
NspI RCATGY 1 cut(s) 226
PcsI WCGNNNNNNNCGW 1 cut(s) 291
PkrI GCNGC 7 cut(s) 81, 94, 97, 127, 303, 355, 543
PleI GAGTC 1 cut(s) 501
PpsI GAGTC 1 cut(s) 501
PpuMI RGGWCCY 1 cut(s) 559
Psp5II RGGWCCY 1 cut(s) 559
Psp6I CCWGG 1 cut(s) 382
PspGI CCWGG 1 cut(s) 382
PspPI GGNCC 1 cut(s) 559
PspPPI RGGWCCY 1 cut(s) 559
RsaI GTAC 3 cut(s) 33, 49, 370
RsaNI GTAC 3 cut(s) 32, 48, 369
SalI GTCGAC 1 cut(s) 500
SaqAI TTAA 1 cut(s) 555
SatI GCNGC 7 cut(s) 80, 93, 96, 126, 302, 354, 542
Sau3AI GATC 3 cut(s) 118, 172, 202
Sau96I GGNCC 1 cut(s) 559
ScaI AGTACT 2 cut(s) 49, 370
SchI GAGTC 1 cut(s) 502
ScrFI CCNGG 1 cut(s) 384
SfaNI GCATC 1 cut(s) 288
SfcI CTRYAG 1 cut(s) 625
SinI GGWCC 1 cut(s) 559
SpeI ACTAGT 2 cut(s) 50, 137
Sse9I AATT 4 cut(s) 248, 433, 526, 619
SsiI CCGC 3 cut(s) 79, 96, 615
SspMI CTAG 3 cut(s) 51, 138, 357
StyD4I CCNGG 1 cut(s) 382
TaaI ACNGT 3 cut(s) 31, 281, 629
TaiI ACGT 1 cut(s) 272
TaqI TCGA 2 cut(s) 156, 501
TasI AATT 4 cut(s) 248, 433, 526, 619
TatI WGTACW 3 cut(s) 31, 47, 368
TauI GCSGC 2 cut(s) 82, 98
Tru1I TTAA 1 cut(s) 555
Tru9I TTAA 1 cut(s) 555
TseI GCWGC 5 cut(s) 92, 125, 301, 353, 541
TspDTI ATGAA 3 cut(s) 126, 587, 591
VpaK11BI GGWCC 1 cut(s) 559
XceI RCATGY 1 cut(s) 226
XmiI GTMKAC 1 cut(s) 501
XspI CTAG 3 cut(s) 51, 138, 357
ZrmI AGTACT 2 cut(s) 49, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.