Rmu_sc0013301.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013301.1
OG0015359
Physical Location & Seq
Reverse (-)
3895 .. 4368
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013301.1_g000002.1.cds

Sequence Viewer

Length: 474 bp
atggccacagatgatttcagcttccccacagtacacaaaagcagtactactagtaacatccatttccctcctctgtggcggccatctccggcagccgcctgcacagatgaagaagaagatcacgcagccctaataactagtcctgtggaggctatcgagggggttgatgatgatcagataatagttagtagtgatgttcaagatcaggagaagaaaatggacatgctatgggaggatttcaatgaggaattgtatccggtaaggtcaacgtcggattacagttacgtgtccggcgagatgctgcaactgggatgtgtaggtcttggtgctttcaacttgtccaaatctaatgctgctagaaatagtagtactattacaaacccaggtgtggtcgtgattgtcaaactcttgaaaaagctattcttcctccataattctcatcatcacaacctcaacaaacctgcaaaacggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

157

Amino Acids

17.43

Weight (kDa)

5.1

Isoelectric Point (pI)

63.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015359)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G71910 AT1G71910
fragaria_vesca FvH4_4g19940
prunus_persica Prupe.8G056300_v2.0.a1
pyrus_communis pycom05g03380
rosa_chinensis RchiOBHm_Chr6g0272051
rosa_laevigata RLG00000013704
rosa_multiflora Rmu_sc0005786.1_g000006 Rmu_sc0013301.1_g000002
rosa_roxburghii Rroxscaffold_7G00196620
rosa_rugosa Rorug06G0065400
rosa_samantha Rh6AG182700 Rh6BG184500 Rh6CG183800 Rh6DG175400
rosa_wichuraiana Rw6G015720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 469
AciI CCGC 2 cut(s) 79, 96
AcoI YGGCCR 2 cut(s) 3, 80
AfaI GTAC 3 cut(s) 33, 46, 370
AfiI CCNNNNNNNGG 1 cut(s) 388
AflIII ACRYGT 1 cut(s) 285
AgsI TTSAA 4 cut(s) 200, 241, 334, 412
AhlI ACTAGT 2 cut(s) 50, 137
AjnI CCWGG 1 cut(s) 382
AluBI AGCT 2 cut(s) 21, 418
AluI AGCT 2 cut(s) 21, 418
AoxI GGCC 2 cut(s) 3, 80
ApeKI GCWGC 4 cut(s) 92, 125, 301, 353
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 4 cut(s) 104, 137, 288, 340
BccI CCATC 1 cut(s) 91
BciT130I CCWGG 1 cut(s) 384
BciVI GTATCC 1 cut(s) 264
BclI TGATCA 1 cut(s) 172
BcuI ACTAGT 2 cut(s) 50, 137
BfaI CTAG 3 cut(s) 51, 138, 357
BfuAI ACCTGC 1 cut(s) 469
BfuI GTATCC 1 cut(s) 264
BisI GCNGC 6 cut(s) 80, 93, 96, 126, 302, 354
BlsI GCNGC 6 cut(s) 81, 94, 97, 127, 303, 355
BmcAI AGTACT 2 cut(s) 46, 370
Bme1390I CCNGG 1 cut(s) 384
BmrFI CCNGG 1 cut(s) 384
BmrI ACTGGG 1 cut(s) 317
BmsI GCATC 1 cut(s) 288
BmuI ACTGGG 1 cut(s) 317
BsaAI YACGTR 1 cut(s) 286
BsaBI GATNNNNATC 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 382
BsaWI WCCGGW 1 cut(s) 256
Bsc4I CCNNNNNNNGG 1 cut(s) 388
Bse1I ACTGG 1 cut(s) 312
Bse8I GATNNNNATC 1 cut(s) 171
BseBI CCWGG 1 cut(s) 384
BseDI CCNNGG 1 cut(s) 382
BseGI GGATG 2 cut(s) 57, 317
BseJI GATNNNNATC 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 388
BseNI ACTGG 1 cut(s) 312
BseRI GAGGAG 1 cut(s) 60
BseXI GCAGC 4 cut(s) 104, 137, 288, 340
BsgI GTGCAG 1 cut(s) 85
BshFI GGCC 2 cut(s) 5, 82
BsiSI CCGG 3 cut(s) 89, 257, 291
BslI CCNNNNNNNGG 1 cut(s) 388
BsnI GGCC 2 cut(s) 5, 82
Bsp143I GATC 3 cut(s) 118, 172, 202
BspACI CCGC 2 cut(s) 79, 96
BspANI GGCC 2 cut(s) 5, 82
BspMI ACCTGC 1 cut(s) 469
BsrI ACTGG 1 cut(s) 312
BssECI CCNNGG 1 cut(s) 382
BssMI GATC 3 cut(s) 118, 172, 202
Bst2UI CCWGG 1 cut(s) 384
Bst4CI ACNGT 3 cut(s) 31, 281, 471
BstBAI YACGTR 1 cut(s) 286
BstC8I GCNNGC 1 cut(s) 100
BstF5I GGATG 2 cut(s) 57, 317
BstKTI GATC 3 cut(s) 121, 175, 205
BstMBI GATC 3 cut(s) 118, 172, 202
BstNI CCWGG 1 cut(s) 384
BstNSI RCATGY 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 382
BstV1I GCAGC 4 cut(s) 104, 137, 288, 340
BsuI GTATCC 1 cut(s) 264
BsuRI GGCC 2 cut(s) 5, 82
BtsCI GGATG 2 cut(s) 57, 317
BveI ACCTGC 1 cut(s) 469
Cac8I GCNNGC 1 cut(s) 100
Csp6I GTAC 3 cut(s) 32, 45, 369
CviAII CATG 1 cut(s) 223
CviJI RGCY 7 cut(s) 5, 21, 82, 95, 128, 152, 418
CviKI_1 RGCY 7 cut(s) 5, 21, 82, 95, 128, 152, 418
CviQI GTAC 3 cut(s) 32, 45, 369
DpnI GATC 3 cut(s) 120, 174, 204
DpnII GATC 3 cut(s) 118, 172, 202
EaeI YGGCCR 2 cut(s) 3, 80
EcoRII CCWGG 1 cut(s) 382
FaeI CATG 1 cut(s) 226
FaiI YATR 3 cut(s) 224, 229, 432
FalI AAGNNNNNCTT 2 cut(s) 407, 439
FatI CATG 1 cut(s) 222
FbaI TGATCA 1 cut(s) 172
Fnu4HI GCNGC 6 cut(s) 80, 93, 96, 126, 302, 354
FokI GGATG 2 cut(s) 44, 324
Fsp4HI GCNGC 6 cut(s) 80, 93, 96, 126, 302, 354
FspBI CTAG 3 cut(s) 51, 138, 357
GluI GCNGC 6 cut(s) 80, 93, 96, 126, 302, 354
HaeIII GGCC 2 cut(s) 5, 82
HapII CCGG 3 cut(s) 89, 257, 291
Hin1II CATG 1 cut(s) 226
HincII GTYRAC 1 cut(s) 267
HindII GTYRAC 1 cut(s) 267
HpaII CCGG 3 cut(s) 89, 257, 291
Hpy166II GTNNAC 2 cut(s) 34, 267
Hpy188I TCNGA 2 cut(s) 177, 274
Hpy188III TCNNGA 4 cut(s) 200, 206, 394, 409
Hpy8I GTNNAC 2 cut(s) 34, 267
Hpy99I CGWCG 1 cut(s) 274
HpyCH4III ACNGT 3 cut(s) 31, 281, 471
HpyCH4IV ACGT 2 cut(s) 269, 285
HpyCH4V TGCA 3 cut(s) 102, 304, 464
HpySE526I ACGT 2 cut(s) 269, 285
Hsp92II CATG 1 cut(s) 226
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 3 cut(s) 118, 172, 202
LpnPI CCDG 9 cut(s) 102, 112, 156, 191, 270, 293, 304, 369, 396
Lsp1109I GCAGC 4 cut(s) 104, 137, 288, 340
LweI GCATC 1 cut(s) 288
MaeI CTAG 3 cut(s) 51, 138, 357
MaeII ACGT 2 cut(s) 269, 285
MaeIII GTNAC 2 cut(s) 53, 281
MalI GATC 3 cut(s) 120, 174, 204
MboI GATC 3 cut(s) 118, 172, 202
MboII GAAGA 5 cut(s) 122, 125, 128, 223, 415
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 248, 433
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 8 cut(s) 78, 81, 142, 151, 226, 238, 437, 461
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 3 cut(s) 89, 257, 291
MspR9I CCNGG 1 cut(s) 384
MvaI CCWGG 1 cut(s) 384
NdeII GATC 3 cut(s) 118, 172, 202
NlaIII CATG 1 cut(s) 226
NspI RCATGY 1 cut(s) 226
PcsI WCGNNNNNNNCGW 1 cut(s) 291
PkrI GCNGC 6 cut(s) 81, 94, 97, 127, 303, 355
Ppu21I YACGTR 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 382
PspGI CCWGG 1 cut(s) 382
RsaI GTAC 3 cut(s) 33, 46, 370
RsaNI GTAC 3 cut(s) 32, 45, 369
SatI GCNGC 6 cut(s) 80, 93, 96, 126, 302, 354
Sau3AI GATC 3 cut(s) 118, 172, 202
ScaI AGTACT 2 cut(s) 46, 370
ScrFI CCNGG 1 cut(s) 384
SetI ASST 9 cut(s) 23, 266, 272, 288, 322, 388, 420, 453, 463
SfaNI GCATC 1 cut(s) 288
SpeI ACTAGT 2 cut(s) 50, 137
Sse9I AATT 2 cut(s) 248, 433
SsiI CCGC 2 cut(s) 79, 96
SspMI CTAG 3 cut(s) 51, 138, 357
StyD4I CCNGG 1 cut(s) 382
TaaI ACNGT 3 cut(s) 31, 281, 471
TaiI ACGT 2 cut(s) 272, 288
TaqI TCGA 1 cut(s) 156
TasI AATT 2 cut(s) 248, 433
TatI WGTACW 3 cut(s) 31, 44, 368
TauI GCSGC 2 cut(s) 82, 98
TseI GCWGC 4 cut(s) 92, 125, 301, 353
TspDTI ATGAA 1 cut(s) 123
XceI RCATGY 1 cut(s) 226
XspI CTAG 3 cut(s) 51, 138, 357
ZrmI AGTACT 2 cut(s) 46, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.