pycom03g13470
NAC Family

Inactive beta-amylase 4

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0004013
Physical Location & Seq
Reverse (-)
14493542 .. 14494055
514 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g13470.2

Sequence Viewer

Length: 201 bp
ATGGCAGTCGTCTGCAAATGCACAACAGCGAGGAGGAGCTTCTTCTGCTTCAGAGAAATCAGTTTCGACGACAAGCCCAACTGCCGAAACCTCCTCCGAAACGTTTCGACCCTGCCCGTCTTTAAAAAAGGCCTCTTCACTTGCTGCAGCCCATCCTTGCTGGAAATAGTATTCTCAGTATGGATGCACGAGAGAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_14

Protein Analysis

67

Amino Acids

7.69

Weight (kDa)

9.15

Isoelectric Point (pI)

66.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 102
AcsI RAATTY 1 cut(s) 195
AcuI CTGAAG 1 cut(s) 34
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
AoxI GGCC 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 144, 147
ApoI RAATTY 1 cut(s) 195
Asp700I GAANNNNTTC 1 cut(s) 103
BauI CACGAG 1 cut(s) 188
BbvI GCAGC 2 cut(s) 131, 159
BccI CCATC 1 cut(s) 160
BfmI CTRYAG 1 cut(s) 145
BisI GCNGC 2 cut(s) 145, 148
BlsI GCNGC 2 cut(s) 146, 149
BmsI GCATC 1 cut(s) 174
BseGI GGATG 2 cut(s) 152, 189
BseMII CTCAG 1 cut(s) 189
BseRI GAGGAG 3 cut(s) 46, 49, 83
BseXI GCAGC 2 cut(s) 131, 159
BshFI GGCC 1 cut(s) 132
BsnI GGCC 1 cut(s) 132
BspANI GGCC 1 cut(s) 132
BspCNI CTCAG 1 cut(s) 188
BspMAI CTGCAG 1 cut(s) 149
BssSI CACGAG 1 cut(s) 188
Bst2BI CACGAG 1 cut(s) 188
Bst6I CTCTTC 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 175
BstF5I GGATG 2 cut(s) 152, 189
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstSFI CTRYAG 1 cut(s) 145
BstV1I GCAGC 2 cut(s) 131, 159
BsuRI GGCC 1 cut(s) 132
BtsCI GGATG 2 cut(s) 152, 189
CviJI RGCY 4 cut(s) 39, 76, 132, 150
CviKI_1 RGCY 4 cut(s) 39, 76, 132, 150
DdeI CTNAG 1 cut(s) 175
DraI TTTAAA 1 cut(s) 124
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
Eco147I AGGCCT 1 cut(s) 132
Eco57I CTGAAG 1 cut(s) 34
FaiI YATR 1 cut(s) 181
Fnu4HI GCNGC 2 cut(s) 145, 148
FokI GGATG 2 cut(s) 139, 196
Fsp4HI GCNGC 2 cut(s) 145, 148
GluI GCNGC 2 cut(s) 145, 148
HaeIII GGCC 1 cut(s) 132
Hpy188I TCNGA 2 cut(s) 53, 98
Hpy99I CGWCG 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 4 cut(s) 15, 21, 147, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpyF3I CTNAG 1 cut(s) 175
HpySE526I ACGT 1 cut(s) 102
LmnI GCTCC 1 cut(s) 36
LpnPI CCDG 2 cut(s) 125, 146
Lsp1109I GCAGC 2 cut(s) 131, 159
LweI GCATC 1 cut(s) 174
MaeII ACGT 1 cut(s) 102
MboII GAAGA 2 cut(s) 34, 127
MluCI AATT 1 cut(s) 195
MnlI CCTC 5 cut(s) 24, 27, 101, 104, 143
MroXI GAANNNNTTC 1 cut(s) 103
MseI TTAA 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 45
PceI AGGCCT 1 cut(s) 132
PdmI GAANNNNTTC 1 cut(s) 103
PkrI GCNGC 2 cut(s) 146, 149
Psp1406I AACGTT 1 cut(s) 102
PstI CTGCAG 1 cut(s) 149
SaqAI TTAA 1 cut(s) 123
SatI GCNGC 2 cut(s) 145, 148
SetI ASST 3 cut(s) 41, 93, 105
SfaNI GCATC 1 cut(s) 174
SfcI CTRYAG 1 cut(s) 145
SgeI CNNG 7 cut(s) 42, 85, 124, 128, 153, 169, 173
Sse9I AATT 1 cut(s) 195
SseBI AGGCCT 1 cut(s) 132
StuI AGGCCT 1 cut(s) 132
TaiI ACGT 1 cut(s) 105
TaqI TCGA 2 cut(s) 66, 107
TasI AATT 1 cut(s) 195
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TseI GCWGC 2 cut(s) 144, 147
XapI RAATTY 1 cut(s) 195
XmnI GAANNNNTTC 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.