Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr5

Orthogroup ID

OG0010509

Physical Location & Seq

Genomic Coordinates Reverse (-)

2216621 .. 2217667

Gene Structure 1047 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom05g01870.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 744 bp

ATGAACCATCTTTATACTTTGGGGTTACAGAAAAATTTAAAAGAGAAGCTCTCAATGAAGTTCTCCATGCTCGTCTTCCTGTGCTTGCTCTCTTTCCTCTTCCAGCATTCTCACTCCACCACAATACTAGTTGATGGAGTTTCAGAGTGGAAAAACCCAACTGTTCATGTGGGAGACTCCGTCACACAAGTATCAGTACAGCCTCTACATTTTCCAGAACCAAAGGGCTTGATCGATCTCTGCAATTTCATTCAAGCCACCCTACTTACCAAACCTAACTCCACCTCCTTCACGTGGCACCCATCACGCACTGGTTTCTTCTACTTTGCCTTCAACAATGCCTCTCTGCTCAAAACATGCCAAAACACCCAAAAGCTGGCCATTATAGTCTCCTCCTCAGCACCGCCGCCGCAAAGTTCAAGTTCAAGTTCAACAATCTCTCCGGAGCTTCCTCCAACGGCGGCCCCAACCCCGAAACCTGGTGGTGGAGGAGCATCTTCTCCAGTATTCCCATGGCCATTCCATCCTCGCCAAGTGGCCTTGTCTCCCAGTCCACAACCAAGCGTAAATTCTTCGGTGACGGATAAAGGCGGCGGTGGAGGCGGAATCCCATTTATTAACAGTAATCCTGCTGTTCCTCTGCCTACTGGTGAAGTGGATTCTGCTACAATACACCCTGTACCAACCTCTGGCCACCAGAGACAGGTAATAATAATACCACTGCGTCTTCCACGTCTTTACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

248

Amino Acids

26.51

Weight (kDa)

9.41

Isoelectric Point (pI)

48.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010509)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21090 AT1G21090
fragaria_vesca	FvH4_2g13650 FvH4_2g13650
malus_domestica	MD05G1026900.v1.1 MD10G1026200.v1.1
prunus_persica	Prupe.8G031400_v2.0.a1
pyrus_communis	pycom05g01870 pycom10g01760 pycom10g01770
rosa_chinensis	RchiOBHm_Chr6g0275291
rosa_laevigata	RLG00000013475
rosa_multiflora	Rmu_co8482861.1_g000001 Rmu_sc0005558.1_g000001
rosa_roxburghii	Rroxscaffold_7G00193430
rosa_rugosa	Rorug06G0090900
rosa_samantha	Rh6AG204500 Rh6BG207300 Rh6CG209900 Rh6DG200300
rosa_wichuraiana	Rw6G017750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	297
AccB7I	CCANNNNNTGG	2 cut(s)	376, 689
AccIII	TCCGGA	1 cut(s)	442
AciI	CCGC	7 cut(s)	404, 407, 410, 461, 591, 594, 603
AcoI	YGGCCR	3 cut(s)	378, 515, 691
AcsI	RAATTY	2 cut(s)	34, 568
AcvI	CACGTG	1 cut(s)	294
AfaI	GTAC	2 cut(s)	198, 681
AfiI	CCNNNNNNNGG	6 cut(s)	294, 376, 479, 485, 689, 703
AgsI	TTSAA	5 cut(s)	254, 334, 420, 426, 432
AhlI	ACTAGT	1 cut(s)	127
AjiI	CACGTC	1 cut(s)	734
AjnI	CCWGG	1 cut(s)	478
AjuI	GAANNNNNNNTTGG	2 cut(s)	553, 585
AluBI	AGCT	3 cut(s)	49, 376, 448
AluI	AGCT	3 cut(s)	49, 376, 448
Alw26I	GTCTC	4 cut(s)	168, 394, 549, 694
Aor13HI	TCCGGA	1 cut(s)	442
AoxI	GGCC	5 cut(s)	378, 462, 515, 537, 691
ApoI	RAATTY	2 cut(s)	34, 568
AspS9I	GGNCC	1 cut(s)	463
AsuHPI	GGTGA	2 cut(s)	589, 662
BaeI	ACNNNNGTAYC	2 cut(s)	174, 207
BalI	TGGCCA	3 cut(s)	380, 517, 693
BanI	GGYRCC	1 cut(s)	297
BbrPI	CACGTG	1 cut(s)	294
BbsI	GAAGAC	2 cut(s)	67, 719
BbvCI	CCTCAGC	1 cut(s)	397
BccI	CCATC	4 cut(s)	15, 128, 310, 531
BceAI	ACGGC	1 cut(s)	474
BciT130I	CCWGG	1 cut(s)	480
BcoDI	GTCTC	4 cut(s)	168, 394, 549, 694
BcuI	ACTAGT	1 cut(s)	127
BfaI	CTAG	1 cut(s)	128
BisI	GCNGC	4 cut(s)	407, 410, 462, 592
BlsI	GCNGC	4 cut(s)	408, 411, 463, 593
Bme1390I	CCNGG	1 cut(s)	480
BmgBI	CACGTC	1 cut(s)	734
BmgT120I	GGNCC	1 cut(s)	463
BmiI	GGNNCC	2 cut(s)	299, 465
BmrFI	CCNGG	1 cut(s)	480
BmrI	ACTGGG	1 cut(s)	543
BmsI	GCATC	1 cut(s)	503
BmuI	ACTGGG	1 cut(s)	543
BpiI	GAAGAC	2 cut(s)	67, 719
BplI	GAGNNNNNCTC	2 cut(s)	35, 67
BpmI	CTGGAG	1 cut(s)	486
Bpu10I	CCTNAGC	1 cut(s)	397
Bsa29I	ATCGAT	1 cut(s)	234
BsaAI	YACGTR	1 cut(s)	294
BsaJI	CCNNGG	1 cut(s)	512
BsaWI	WCCGGW	1 cut(s)	442
BsaXI	ACNNNNNCTCC	6 cut(s)	165, 195, 269, 299, 424, 454
Bsc4I	CCNNNNNNNGG	6 cut(s)	294, 376, 479, 485, 689, 703
Bse1I	ACTGG	4 cut(s)	316, 503, 549, 652
BseAI	TCCGGA	1 cut(s)	442
BseBI	CCWGG	1 cut(s)	480
BseCI	ATCGAT	1 cut(s)	234
BseDI	CCNNGG	1 cut(s)	512
BseGI	GGATG	1 cut(s)	523
BseLI	CCNNNNNNNGG	6 cut(s)	294, 376, 479, 485, 689, 703
BseMII	CTCAG	1 cut(s)	411
BseNI	ACTGG	4 cut(s)	316, 503, 549, 652
BseRI	GAGGAG	3 cut(s)	382, 385, 504
BshFI	GGCC	5 cut(s)	380, 464, 517, 539, 693
BshNI	GGYRCC	1 cut(s)	297
BshVI	ATCGAT	1 cut(s)	234
BsiSI	CCGG	1 cut(s)	443
BslI	CCNNNNNNNGG	6 cut(s)	294, 376, 479, 485, 689, 703
BsmAI	GTCTC	4 cut(s)	168, 394, 549, 694
BsmI	GAATGC	1 cut(s)	106
BsnI	GGCC	5 cut(s)	380, 464, 517, 539, 693
Bsp13I	TCCGGA	1 cut(s)	442
Bsp143I	GATC	2 cut(s)	231, 235
Bsp19I	CCATGG	1 cut(s)	512
BspACI	CCGC	7 cut(s)	404, 407, 410, 461, 591, 594, 603
BspANI	GGCC	5 cut(s)	380, 464, 517, 539, 693
BspCNI	CTCAG	1 cut(s)	410
BspDI	ATCGAT	1 cut(s)	234
BspEI	TCCGGA	1 cut(s)	442
BspLI	GGNNCC	2 cut(s)	299, 465
BspT107I	GGYRCC	1 cut(s)	297
BsrI	ACTGG	4 cut(s)	316, 503, 549, 652
BssECI	CCNNGG	1 cut(s)	512
BssMI	GATC	2 cut(s)	231, 235
BssT1I	CCWWGG	1 cut(s)	512
Bst2UI	CCWGG	1 cut(s)	480
Bst4CI	ACNGT	2 cut(s)	163, 623
Bst6I	CTCTTC	1 cut(s)	104
BstBAI	YACGTR	1 cut(s)	294
BstC8I	GCNNGC	2 cut(s)	86, 378
BstDEI	CTNAG	1 cut(s)	397
BstDSI	CCRYGG	1 cut(s)	512
BstF5I	GGATG	1 cut(s)	523
BstKTI	GATC	2 cut(s)	234, 238
BstMAI	GTCTC	4 cut(s)	168, 394, 549, 694
BstMBI	GATC	2 cut(s)	231, 235
BstMWI	GCNNNNNNNGC	1 cut(s)	600
BstNI	CCWGG	1 cut(s)	480
BstNSI	RCATGY	1 cut(s)	360
BstSCI	CCNGG	1 cut(s)	478
BstV2I	GAAGAC	2 cut(s)	67, 719
Bsu15I	ATCGAT	1 cut(s)	234
BsuRI	GGCC	5 cut(s)	380, 464, 517, 539, 693
BsuTUI	ATCGAT	1 cut(s)	234
BtgI	CCRYGG	1 cut(s)	512
BtrI	CACGTC	1 cut(s)	734
BtsCI	GGATG	1 cut(s)	523
BtsI	GCAGTG	1 cut(s)	719
BtsIMutI	CAGTG	2 cut(s)	309, 719
Cac8I	GCNNGC	2 cut(s)	86, 378
Cfr13I	GGNCC	1 cut(s)	463
ClaI	ATCGAT	1 cut(s)	234
CseI	GACGC	1 cut(s)	713
CsiI	ACCWGGT	1 cut(s)	478
Csp6I	GTAC	2 cut(s)	197, 680
CviAII	CATG	4 cut(s)	67, 167, 357, 513
CviQI	GTAC	2 cut(s)	197, 680
DdeI	CTNAG	1 cut(s)	397
DpnI	GATC	2 cut(s)	233, 237
DpnII	GATC	2 cut(s)	231, 235
DraI	TTTAAA	1 cut(s)	39
EaeI	YGGCCR	3 cut(s)	378, 515, 691
Eam1104I	CTCTTC	1 cut(s)	104
EarI	CTCTTC	1 cut(s)	104
EciI	GGCGGA	1 cut(s)	618
Eco130I	CCWWGG	1 cut(s)	512
Eco72I	CACGTG	1 cut(s)	294
EcoRII	CCWGG	1 cut(s)	478
EcoT14I	CCWWGG	1 cut(s)	512
ErhI	CCWWGG	1 cut(s)	512
FaeI	CATG	4 cut(s)	70, 170, 360, 516
FaiI	YATR	6 cut(s)	15, 68, 168, 358, 386, 514
FatI	CATG	4 cut(s)	66, 166, 356, 512
Fnu4HI	GCNGC	4 cut(s)	407, 410, 462, 592
FokI	GGATG	1 cut(s)	510
Fsp4HI	GCNGC	4 cut(s)	407, 410, 462, 592
FspBI	CTAG	1 cut(s)	128
GluI	GCNGC	4 cut(s)	407, 410, 462, 592
GsuI	CTGGAG	1 cut(s)	486
HaeIII	GGCC	5 cut(s)	380, 464, 517, 539, 693
HapII	CCGG	1 cut(s)	443
HgaI	GACGC	1 cut(s)	713
Hin1II	CATG	4 cut(s)	70, 170, 360, 516
HinfI	GANTC	3 cut(s)	176, 606, 659
HpaII	CCGG	1 cut(s)	443
HphI	GGTGA	2 cut(s)	589, 662
Hpy166II	GTNNAC	1 cut(s)	554
Hpy188I	TCNGA	1 cut(s)	145
Hpy188III	TCNNGA	2 cut(s)	215, 443
Hpy8I	GTNNAC	1 cut(s)	554
HpyAV	CCTTC	2 cut(s)	298, 340
HpyCH4III	ACNGT	2 cut(s)	163, 623
HpyCH4IV	ACGT	2 cut(s)	293, 733
HpyCH4V	TGCA	1 cut(s)	243
HpyF10VI	GCNNNNNNNGC	1 cut(s)	600
HpyF3I	CTNAG	1 cut(s)	397
HpySE526I	ACGT	2 cut(s)	293, 733
Hsp92II	CATG	4 cut(s)	70, 170, 360, 516
Kpn2I	TCCGGA	1 cut(s)	442
Kzo9I	GATC	2 cut(s)	231, 235
LmnI	GCTCC	2 cut(s)	445, 491
LweI	GCATC	1 cut(s)	503
MabI	ACCWGGT	1 cut(s)	478
MaeI	CTAG	1 cut(s)	128
MaeII	ACGT	2 cut(s)	293, 733
MaeIII	GTNAC	3 cut(s)	24, 181, 577
MalI	GATC	2 cut(s)	233, 237
MboI	GATC	2 cut(s)	231, 235
MboII	GAAGA	6 cut(s)	67, 91, 310, 489, 564, 719
MlsI	TGGCCA	3 cut(s)	380, 517, 693
MluCI	AATT	3 cut(s)	34, 244, 568
MluNI	TGGCCA	3 cut(s)	380, 517, 693
MlyI	GAGTC	1 cut(s)	170
MmeI	TCCRAC	1 cut(s)	479
Mox20I	TGGCCA	3 cut(s)	380, 517, 693
MroI	TCCGGA	1 cut(s)	442
MscI	TGGCCA	3 cut(s)	380, 517, 693
MseI	TTAA	2 cut(s)	38, 618
Msp20I	TGGCCA	3 cut(s)	380, 517, 693
MspI	CCGG	1 cut(s)	443
MspR9I	CCNGG	1 cut(s)	480
Mva1269I	GAATGC	1 cut(s)	106
MvaI	CCWGG	1 cut(s)	480
MwoI	GCNNNNNNNGC	1 cut(s)	600
NcoI	CCATGG	1 cut(s)	512
NdeII	GATC	2 cut(s)	231, 235
NlaIII	CATG	4 cut(s)	70, 170, 360, 516
NlaIV	GGNNCC	2 cut(s)	299, 465
NmuCI	GTSAC	2 cut(s)	181, 577
NspI	RCATGY	1 cut(s)	360
PctI	GAATGC	1 cut(s)	106
PfeI	GAWTC	2 cut(s)	606, 659
PflFI	GACNNNGTC	1 cut(s)	179
PflMI	CCANNNNNTGG	2 cut(s)	376, 689
PkrI	GCNGC	4 cut(s)	408, 411, 463, 593
PleI	GAGTC	1 cut(s)	170
PmaCI	CACGTG	1 cut(s)	294
PmlI	CACGTG	1 cut(s)	294
PpsI	GAGTC	1 cut(s)	170
Ppu21I	YACGTR	1 cut(s)	294
Psp6I	CCWGG	1 cut(s)	478
PspCI	CACGTG	1 cut(s)	294
PspGI	CCWGG	1 cut(s)	478
PspN4I	GGNNCC	2 cut(s)	299, 465
PspPI	GGNCC	1 cut(s)	463
PsyI	GACNNNGTC	1 cut(s)	179
RsaI	GTAC	2 cut(s)	198, 681
RsaNI	GTAC	2 cut(s)	197, 680
SaqAI	TTAA	2 cut(s)	38, 618
SatI	GCNGC	4 cut(s)	407, 410, 462, 592
Sau3AI	GATC	2 cut(s)	231, 235
Sau96I	GGNCC	1 cut(s)	463
SchI	GAGTC	1 cut(s)	170
ScrFI	CCNGG	1 cut(s)	480
SexAI	ACCWGGT	1 cut(s)	478
SfaNI	GCATC	1 cut(s)	503
SpeI	ACTAGT	1 cut(s)	127
Sse9I	AATT	3 cut(s)	34, 244, 568
SsiI	CCGC	7 cut(s)	404, 407, 410, 461, 591, 594, 603
SspMI	CTAG	1 cut(s)	128
StyD4I	CCNGG	1 cut(s)	478
StyI	CCWWGG	1 cut(s)	512
TaaI	ACNGT	2 cut(s)	163, 623
TaiI	ACGT	2 cut(s)	296, 736
TaqI	TCGA	1 cut(s)	234
TasI	AATT	3 cut(s)	34, 244, 568
TatI	WGTACW	1 cut(s)	196
TauI	GCSGC	4 cut(s)	409, 412, 464, 594
TfiI	GAWTC	2 cut(s)	606, 659
Tru1I	TTAA	2 cut(s)	38, 618
Tru9I	TTAA	2 cut(s)	38, 618
TscAI	CASTG	2 cut(s)	316, 726
TseFI	GTSAC	2 cut(s)	181, 577
Tsp45I	GTSAC	2 cut(s)	181, 577
TspDTI	ATGAA	4 cut(s)	17, 71, 155, 238
TspGWI	ACGGA	2 cut(s)	169, 596
TspRI	CASTG	2 cut(s)	316, 726
Tth111I	GACNNNGTC	1 cut(s)	179
Van91I	CCANNNNNTGG	2 cut(s)	376, 689
XapI	RAATTY	2 cut(s)	34, 568
XceI	RCATGY	1 cut(s)	360
XcmI	CCANNNNNNNNNTGG	1 cut(s)	510
XspI	CTAG	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.