Rmu_co8482861.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8482861.1
Physical Location & Seq
Forward (+)
1486 .. 1850
365 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8482861.1_g000001.1.cds

Sequence Viewer

Length: 255 bp
atgttcttcttcctctgtttgctccctttactcttccagcattctcactccaccataatactagtggatggagtttcagagtggaagaaccctactgttcatgttggagactccatcattttcaagcacaagtatcactacaacctctacattttccagaaccaaagagccttcaatgtctgcaatttcactcgagccacacttcttaataaacccgattccacatcctatacggtatggcatctctttccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.96

Weight (kDa)

8.69

Isoelectric Point (pI)

28.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 124, 175
AhlI ACTAGT 1 cut(s) 61
Alw26I GTCTC 1 cut(s) 102
Ama87I CYCGRG 1 cut(s) 192
AvaI CYCGRG 1 cut(s) 192
BccI CCATC 2 cut(s) 62, 122
BcoDI GTCTC 1 cut(s) 102
BcuI ACTAGT 1 cut(s) 61
BfaI CTAG 1 cut(s) 62
BmeT110I CYCGRG 1 cut(s) 192
BmsI GCATC 1 cut(s) 250
BseGI GGATG 2 cut(s) 73, 224
BsiHKCI CYCGRG 1 cut(s) 192
BsmAI GTCTC 1 cut(s) 102
BsmI GAATGC 1 cut(s) 40
BsoBI CYCGRG 1 cut(s) 192
Bst4CI ACNGT 2 cut(s) 97, 235
Bst6I CTCTTC 1 cut(s) 38
BstF5I GGATG 2 cut(s) 73, 224
BstMAI GTCTC 1 cut(s) 102
BtsCI GGATG 2 cut(s) 73, 224
CviAII CATG 1 cut(s) 101
CviJI RGCY 2 cut(s) 170, 197
CviKI_1 RGCY 2 cut(s) 170, 197
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
Eco88I CYCGRG 1 cut(s) 192
FaeI CATG 1 cut(s) 104
FaiI YATR 4 cut(s) 56, 102, 231, 238
FatI CATG 1 cut(s) 100
FokI GGATG 2 cut(s) 80, 211
FspBI CTAG 1 cut(s) 62
Hin1II CATG 1 cut(s) 104
HinfI GANTC 2 cut(s) 110, 218
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 2 cut(s) 97, 235
HpyCH4V TGCA 1 cut(s) 183
Hsp92II CATG 1 cut(s) 104
LmnI GCTCC 1 cut(s) 27
LpnPI CCDG 2 cut(s) 50, 170
LweI GCATC 1 cut(s) 250
MaeI CTAG 1 cut(s) 62
MboII GAAGA 2 cut(s) 25, 97
MluCI AATT 1 cut(s) 184
MlyI GAGTC 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 2 cut(s) 23, 155
MseI TTAA 1 cut(s) 207
Mva1269I GAATGC 1 cut(s) 40
NlaIII CATG 1 cut(s) 104
PaeR7I CTCGAG 1 cut(s) 192
PctI GAATGC 1 cut(s) 40
PfeI GAWTC 1 cut(s) 218
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
PspXI VCTCGAGB 1 cut(s) 192
SaqAI TTAA 1 cut(s) 207
SchI GAGTC 1 cut(s) 104
SetI ASST 1 cut(s) 147
SfaNI GCATC 1 cut(s) 250
Sfr274I CTCGAG 1 cut(s) 192
SgeI CNNG 9 cut(s) 49, 74, 113, 136, 142, 169, 204, 206, 227
SlaI CTCGAG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 192
SmoI CTYRAG 1 cut(s) 192
SpeI ACTAGT 1 cut(s) 61
Sse9I AATT 1 cut(s) 184
SspMI CTAG 1 cut(s) 62
TaaI ACNGT 2 cut(s) 97, 235
TaqI TCGA 1 cut(s) 193
TasI AATT 1 cut(s) 184
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 61
XhoI CTCGAG 1 cut(s) 192
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.