Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0010509

Physical Location & Seq

Genomic Coordinates Forward (+)

37065968 .. 37068363

Gene Structure 2396 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ24698

Sequence Viewer

CDS Protein Promoter (2k)

Length: 696 bp

ATGAAGTTCTCCATGTTCTTCTTCCTCTGTTTGCTCCCTTTACTCTTCCAGCATTCTCACTCCACCACAATACTAGTGGATGGAGTTTCAGAGTGGAAGAACCCTACTGTTCACGTTGGAGACTCCATCATTTTCAAGCACAAGTATCACTACAACCTCTACATTTTCCAGAACCAAAGAGCCTTCAATGTCTGCAATTTCACTCGAGCCACACTTCTTAATAAACCCGATTCCACCTCCTATACGTGGCACCCATCACGGCCCGGTTTCTTCTACTTCTCCTTCAACAACGGTTCTCTGCTCAATACATGCCAAGACACACAAAAGCTTGCCATAAAAGTTGCTTTAACAGCAATGGCTCCAGTGGCAGCCCCAGAGCCCAGTTCCAAGACAGGTTCTGGTGGCAGTGGCAGTGGTGGTGGTGTAGTGTCATCTTCTCCAACATATCCATGGCCTTTCCAACCTCACCAAGCTTCCTTATCGCCAAGTCCAGGGCCAAGTGTCGGCTCTTTAATTCCAAATAAAGGTGCTGGCATGCCATTTATCAACAGCAACCCTGCTGTTCCTTTGCCTACTGGTGAAGTTGATTCTGCTACAATTCGCCCTATACCAACATCTGGCCACCAGGGACAGGTGTTGGTGGGGTTATTTGCTGCGCAAATGGCTCTATTTAGTGTGGTTCTCTTGATGCTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

231

Amino Acids

24.89

Weight (kDa)

9.22

Isoelectric Point (pI)

40.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010509)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21090 AT1G21090
fragaria_vesca	FvH4_2g13650 FvH4_2g13650
malus_domestica	MD05G1026900.v1.1 MD10G1026200.v1.1
prunus_persica	Prupe.8G031400_v2.0.a1
pyrus_communis	pycom05g01870 pycom10g01760 pycom10g01770
rosa_chinensis	RchiOBHm_Chr6g0275291
rosa_laevigata	RLG00000013475
rosa_multiflora	Rmu_co8482861.1_g000001 Rmu_sc0005558.1_g000001
rosa_roxburghii	Rroxscaffold_7G00193430
rosa_rugosa	Rorug06G0090900
rosa_samantha	Rh6AG204500 Rh6BG207300 Rh6CG209900 Rh6DG200300
rosa_wichuraiana	Rw6G017750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	657
AccB1I	GGYRCC	1 cut(s)	249
AccB7I	CCANNNNNTGG	1 cut(s)	617
AcoI	YGGCCR	1 cut(s)	619
AfiI	CCNNNNNNNGG	6 cut(s)	246, 491, 503, 524, 617, 631
AgsI	TTSAA	3 cut(s)	136, 187, 286
AhlI	ACTAGT	1 cut(s)	73
AjnI	CCWGG	2 cut(s)	490, 624
AluBI	AGCT	2 cut(s)	328, 473
AluI	AGCT	2 cut(s)	328, 473
Alw26I	GTCTC	1 cut(s)	114
AlwNI	CAGNNNCTG	1 cut(s)	398
Ama87I	CYCGRG	1 cut(s)	204
AoxI	GGCC	4 cut(s)	260, 452, 494, 619
ApeKI	GCWGC	2 cut(s)	368, 653
AspLEI	GCGC	1 cut(s)	658
AspS9I	GGNCC	2 cut(s)	261, 494
AsuC2I	CCSGG	1 cut(s)	264
AsuHPI	GGTGA	2 cut(s)	458, 590
AvaI	CYCGRG	1 cut(s)	204
BalI	TGGCCA	1 cut(s)	621
BanI	GGYRCC	1 cut(s)	249
BanII	GRGCYC	1 cut(s)	381
BbvI	GCAGC	2 cut(s)	380, 640
BccI	CCATC	3 cut(s)	74, 134, 262
BceAI	ACGGC	1 cut(s)	275
BciT130I	CCWGG	2 cut(s)	492, 626
BcnI	CCSGG	1 cut(s)	264
BcoDI	GTCTC	1 cut(s)	114
BcuI	ACTAGT	1 cut(s)	73
BfaI	CTAG	1 cut(s)	74
BisI	GCNGC	2 cut(s)	369, 654
BlsI	GCNGC	2 cut(s)	370, 655
Bme1390I	CCNGG	3 cut(s)	264, 492, 626
BmeT110I	CYCGRG	1 cut(s)	204
BmgT120I	GGNCC	2 cut(s)	261, 494
BmiI	GGNNCC	2 cut(s)	251, 360
BmrFI	CCNGG	3 cut(s)	264, 492, 626
BmrI	ACTGGG	1 cut(s)	375
BmsI	GCATC	1 cut(s)	678
BmuI	ACTGGG	1 cut(s)	375
BpmI	CTGGAG	1 cut(s)	345
BpuMI	CCSGG	1 cut(s)	264
BsaAI	YACGTR	1 cut(s)	246
BsaJI	CCNNGG	3 cut(s)	449, 491, 625
Bsc4I	CCNNNNNNNGG	6 cut(s)	246, 491, 503, 524, 617, 631
Bse1I	ACTGG	3 cut(s)	362, 381, 580
Bse3DI	GCAATG	1 cut(s)	360
BseBI	CCWGG	2 cut(s)	492, 626
BseDI	CCNNGG	3 cut(s)	449, 491, 625
BseGI	GGATG	1 cut(s)	85
BseLI	CCNNNNNNNGG	6 cut(s)	246, 491, 503, 524, 617, 631
BseMI	GCAATG	1 cut(s)	360
BseNI	ACTGG	3 cut(s)	362, 381, 580
BseXI	GCAGC	2 cut(s)	380, 640
BshFI	GGCC	4 cut(s)	262, 454, 496, 621
BshNI	GGYRCC	1 cut(s)	249
BsiHKCI	CYCGRG	1 cut(s)	204
BsiSI	CCGG	1 cut(s)	264
BslFI	GGGAC	1 cut(s)	642
BslI	CCNNNNNNNGG	6 cut(s)	246, 491, 503, 524, 617, 631
BsmAI	GTCTC	1 cut(s)	114
BsmFI	GGGAC	1 cut(s)	642
BsmI	GAATGC	1 cut(s)	52
BsnI	GGCC	4 cut(s)	262, 454, 496, 621
BsoBI	CYCGRG	1 cut(s)	204
Bsp1286I	GDGCHC	1 cut(s)	381
Bsp19I	CCATGG	1 cut(s)	449
BspANI	GGCC	4 cut(s)	262, 454, 496, 621
BspLI	GGNNCC	2 cut(s)	251, 360
BspT107I	GGYRCC	1 cut(s)	249
BsrDI	GCAATG	1 cut(s)	360
BsrI	ACTGG	3 cut(s)	362, 381, 580
BssECI	CCNNGG	3 cut(s)	449, 491, 625
BssT1I	CCWWGG	1 cut(s)	449
Bst2UI	CCWGG	2 cut(s)	492, 626
Bst4CI	ACNGT	2 cut(s)	109, 293
Bst6I	CTCTTC	1 cut(s)	50
BstBAI	YACGTR	1 cut(s)	246
BstC8I	GCNNGC	3 cut(s)	330, 532, 536
BstDSI	CCRYGG	1 cut(s)	449
BstF5I	GGATG	1 cut(s)	85
BstHHI	GCGC	1 cut(s)	658
BstMAI	GTCTC	1 cut(s)	114
BstMWI	GCNNNNNNNGC	3 cut(s)	350, 365, 662
BstNI	CCWGG	2 cut(s)	492, 626
BstNSI	RCATGY	2 cut(s)	312, 538
BstSCI	CCNGG	3 cut(s)	262, 490, 624
BstV1I	GCAGC	2 cut(s)	380, 640
BsuRI	GGCC	4 cut(s)	262, 454, 496, 621
BtgI	CCRYGG	1 cut(s)	449
BtsCI	GGATG	1 cut(s)	85
BtsI	GCAGTG	2 cut(s)	412, 418
BtsIMutI	CAGTG	3 cut(s)	369, 412, 418
Cac8I	GCNNGC	3 cut(s)	330, 532, 536
CaiI	CAGNNNCTG	1 cut(s)	398
CfoI	GCGC	1 cut(s)	658
Cfr13I	GGNCC	2 cut(s)	261, 494
CspCI	CAANNNNNGTGG	2 cut(s)	57, 92
CviAII	CATG	4 cut(s)	13, 309, 450, 535
EaeI	YGGCCR	1 cut(s)	619
Eam1104I	CTCTTC	1 cut(s)	50
EarI	CTCTTC	1 cut(s)	50
Eco130I	CCWWGG	1 cut(s)	449
Eco24I	GRGCYC	1 cut(s)	381
Eco88I	CYCGRG	1 cut(s)	204
EcoRII	CCWGG	2 cut(s)	490, 624
EcoT14I	CCWWGG	1 cut(s)	449
EcoT38I	GRGCYC	1 cut(s)	381
ErhI	CCWWGG	1 cut(s)	449
FaeI	CATG	4 cut(s)	16, 312, 453, 538
FaiI	YATR	8 cut(s)	14, 243, 310, 335, 445, 451, 536, 608
FaqI	GGGAC	1 cut(s)	642
FatI	CATG	4 cut(s)	12, 308, 449, 534
Fnu4HI	GCNGC	2 cut(s)	369, 654
FokI	GGATG	1 cut(s)	92
FriOI	GRGCYC	1 cut(s)	381
Fsp4HI	GCNGC	2 cut(s)	369, 654
FspBI	CTAG	1 cut(s)	74
FspI	TGCGCA	1 cut(s)	657
GlaI	GCGC	1 cut(s)	657
GluI	GCNGC	2 cut(s)	369, 654
GsuI	CTGGAG	1 cut(s)	345
HaeIII	GGCC	4 cut(s)	262, 454, 496, 621
HapII	CCGG	1 cut(s)	264
HhaI	GCGC	1 cut(s)	658
Hin1II	CATG	4 cut(s)	16, 312, 453, 538
Hin6I	GCGC	1 cut(s)	656
HinP1I	GCGC	1 cut(s)	656
HindIII	AAGCTT	2 cut(s)	326, 471
HinfI	GANTC	3 cut(s)	122, 230, 587
HpaII	CCGG	1 cut(s)	264
HphI	GGTGA	2 cut(s)	458, 590
Hpy166II	GTNNAC	1 cut(s)	112
Hpy188I	TCNGA	1 cut(s)	91
Hpy188III	TCNNGA	2 cut(s)	169, 685
Hpy8I	GTNNAC	1 cut(s)	112
HpyAV	CCTTC	2 cut(s)	193, 292
HpyCH4III	ACNGT	2 cut(s)	109, 293
HpyCH4IV	ACGT	2 cut(s)	114, 245
HpyCH4V	TGCA	1 cut(s)	195
HpyF10VI	GCNNNNNNNGC	3 cut(s)	350, 365, 662
HpySE526I	ACGT	2 cut(s)	114, 245
Hsp92II	CATG	4 cut(s)	16, 312, 453, 538
HspAI	GCGC	1 cut(s)	656
LmnI	GCTCC	2 cut(s)	39, 364
Lsp1109I	GCAGC	2 cut(s)	380, 640
LweI	GCATC	1 cut(s)	678
MaeI	CTAG	1 cut(s)	74
MaeII	ACGT	2 cut(s)	114, 245
MboII	GAAGA	6 cut(s)	10, 13, 37, 109, 262, 426
MhlI	GDGCHC	1 cut(s)	381
MlsI	TGGCCA	1 cut(s)	621
MluCI	AATT	3 cut(s)	196, 513, 597
MluNI	TGGCCA	1 cut(s)	621
MlyI	GAGTC	1 cut(s)	116
MmeI	TCCRAC	3 cut(s)	97, 464, 484
MnlI	CCTC	4 cut(s)	35, 167, 247, 474
Mox20I	TGGCCA	1 cut(s)	621
MscI	TGGCCA	1 cut(s)	621
MseI	TTAA	3 cut(s)	219, 347, 512
MslI	CAYNNNNRTG	1 cut(s)	448
Msp20I	TGGCCA	1 cut(s)	621
MspI	CCGG	1 cut(s)	264
MspR9I	CCNGG	3 cut(s)	264, 492, 626
Mva1269I	GAATGC	1 cut(s)	52
MvaI	CCWGG	2 cut(s)	492, 626
MwoI	GCNNNNNNNGC	3 cut(s)	350, 365, 662
NciI	CCSGG	1 cut(s)	264
NcoI	CCATGG	1 cut(s)	449
NlaIII	CATG	4 cut(s)	16, 312, 453, 538
NlaIV	GGNNCC	2 cut(s)	251, 360
NsbI	TGCGCA	1 cut(s)	657
NspI	RCATGY	2 cut(s)	312, 538
PaeI	GCATGC	1 cut(s)	538
PaeR7I	CTCGAG	1 cut(s)	204
PctI	GAATGC	1 cut(s)	52
PfeI	GAWTC	2 cut(s)	230, 587
PflMI	CCANNNNNTGG	1 cut(s)	617
PkrI	GCNGC	2 cut(s)	370, 655
PleI	GAGTC	1 cut(s)	116
PpsI	GAGTC	1 cut(s)	116
Ppu21I	YACGTR	1 cut(s)	246
Psp6I	CCWGG	2 cut(s)	490, 624
PspGI	CCWGG	2 cut(s)	490, 624
PspN4I	GGNNCC	2 cut(s)	251, 360
PspPI	GGNCC	2 cut(s)	261, 494
PspXI	VCTCGAGB	1 cut(s)	204
PstNI	CAGNNNCTG	1 cut(s)	398
RseI	CAYNNNNRTG	1 cut(s)	448
SaqAI	TTAA	3 cut(s)	219, 347, 512
SatI	GCNGC	2 cut(s)	369, 654
Sau96I	GGNCC	2 cut(s)	261, 494
SchI	GAGTC	1 cut(s)	116
ScrFI	CCNGG	3 cut(s)	264, 492, 626
SduI	GDGCHC	1 cut(s)	381
SfaNI	GCATC	1 cut(s)	678
Sfr274I	CTCGAG	1 cut(s)	204
SlaI	CTCGAG	1 cut(s)	204
SmiMI	CAYNNNNRTG	1 cut(s)	448
SmlI	CTYRAG	1 cut(s)	204
SmoI	CTYRAG	1 cut(s)	204
SpeI	ACTAGT	1 cut(s)	73
SphI	GCATGC	1 cut(s)	538
Sse9I	AATT	3 cut(s)	196, 513, 597
SspMI	CTAG	1 cut(s)	74
StyD4I	CCNGG	3 cut(s)	262, 490, 624
StyI	CCWWGG	1 cut(s)	449
TaaI	ACNGT	2 cut(s)	109, 293
TaiI	ACGT	2 cut(s)	117, 248
TaqI	TCGA	1 cut(s)	205
TasI	AATT	3 cut(s)	196, 513, 597
TfiI	GAWTC	2 cut(s)	230, 587
Tru1I	TTAA	3 cut(s)	219, 347, 512
Tru9I	TTAA	3 cut(s)	219, 347, 512
TscAI	CASTG	3 cut(s)	369, 412, 418
TseI	GCWGC	2 cut(s)	368, 653
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	3 cut(s)	369, 412, 418
Van91I	CCANNNNNTGG	1 cut(s)	617
XceI	RCATGY	2 cut(s)	312, 538
XcmI	CCANNNNNNNNNTGG	2 cut(s)	73, 447
XhoI	CTCGAG	1 cut(s)	204
XspI	CTAG	1 cut(s)	74

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.