pycom07g22290

Kinase-like protein TMKL1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
23681082 .. 23681315
234 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g22290.1

Sequence Viewer

Length: 234 bp
ATGAACAGAACCCAGATACTAACTTTGATTGTTGCACTGACTTCATCGACAACTTTGGTGTTTTTCCTGCTTTTCATCTACTTTTACTGCAAGAAAACTGGAAAAGGTGAGCAAAAAGATGTGGAAAAAACAGAGCAGAAGCAAGAGGAAGTTGTGGAGGCAGAGGAGGAGCTGGTGACTTTTCAGGATGGGGAGGACCTCACAGTCTGTGACATTCTCGATGCTCCGGTTTGA

Protein Analysis

78

Amino Acids

8.79

Weight (kDa)

4.28

Isoelectric Point (pI)

53.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013548)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 203
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 196
AsuHPI GGTGA 2 cut(s) 119, 187
AvaII GGWCC 1 cut(s) 196
BccI CCATC 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmsI GCATC 1 cut(s) 211
BsaWI WCCGGW 1 cut(s) 226
Bse1I ACTGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 103
BseRI GAGGAG 2 cut(s) 179, 182
BsiSI CCGG 1 cut(s) 227
BsrI ACTGG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 205
BstF5I GGATG 1 cut(s) 193
BtsCI GGATG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 196
CviJI RGCY 1 cut(s) 172
CviKI_1 RGCY 1 cut(s) 172
DrdI GACNNNNNNGTC 1 cut(s) 203
DseDI GACNNNNNNGTC 1 cut(s) 203
Eco47I GGWCC 1 cut(s) 196
EcoO109I RGGNCCY 1 cut(s) 196
FokI GGATG 1 cut(s) 200
HapII CCGG 1 cut(s) 227
HpaII CCGG 1 cut(s) 227
HphI GGTGA 2 cut(s) 119, 187
Hpy188III TCNNGA 2 cut(s) 185, 218
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 35, 90
LmnI GCTCC 2 cut(s) 169, 229
LpnPI CCDG 5 cut(s) 26, 80, 84, 158, 170
LweI GCATC 1 cut(s) 211
MaeIII GTNAC 2 cut(s) 175, 209
MnlI CCTC 6 cut(s) 139, 151, 157, 160, 187, 209
MspI CCGG 1 cut(s) 227
NmuCI GTSAC 2 cut(s) 175, 209
PpuMI RGGWCCY 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 196
PspPI GGNCC 1 cut(s) 196
PspPPI RGGWCCY 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 196
SetI ASST 3 cut(s) 109, 174, 201
SfaNI GCATC 1 cut(s) 211
SgeI CNNG 8 cut(s) 25, 79, 103, 111, 155, 185, 197, 230
SinI GGWCC 1 cut(s) 196
TaaI ACNGT 1 cut(s) 205
TaqI TCGA 2 cut(s) 47, 219
TscAI CASTG 1 cut(s) 42
TseFI GTSAC 2 cut(s) 175, 209
Tsp45I GTSAC 2 cut(s) 175, 209
TspDTI ATGAA 3 cut(s) 17, 33, 64
TspRI CASTG 1 cut(s) 42
VpaK11BI GGWCC 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.