pycom08g10430

Ribonuclease H2 subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Forward (+)
8724661 .. 8725483
823 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g10430.1

Sequence Viewer

Length: 219 bp
ATGCTGCAGGGGAAGAGAAAGACATTGTCCAATTTCATGACTGATGCAGTTTCAGTATTGGGGGAATACGTGAAGGATGAGCCCTGGTTGAAGCTTTTGAGTGACCGTTTGAGTATAGATTTTACAGAAGCAACGAGAAAAATGTCAGATATCGAATTTCTCCCGACTGCCACAGGAAGTAACCTGGGGCCTTGTAATGGTTCACAGGAAAAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.97

Weight (kDa)

5.24

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 197
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 2 cut(s) 83, 183
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AoxI GGCC 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 188
BanII GRGCYC 1 cut(s) 84
BciT130I CCWGG 2 cut(s) 85, 185
BfmI CTRYAG 1 cut(s) 5
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 2 cut(s) 85, 185
BmgT120I GGNCC 1 cut(s) 188
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 2 cut(s) 85, 185
BmsI GCATC 1 cut(s) 34
BsaAI YACGTR 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 83, 184
Bsc4I CCNNNNNNNGG 1 cut(s) 197
BseBI CCWGG 2 cut(s) 85, 185
BseDI CCNNGG 2 cut(s) 83, 184
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 197
BshFI GGCC 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 197
BsnI GGCC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 84
BspANI GGCC 1 cut(s) 190
BspHI TCATGA 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 189
BspMAI CTGCAG 1 cut(s) 9
BssECI CCNNGG 2 cut(s) 83, 184
Bst2UI CCWGG 2 cut(s) 85, 185
Bst4CI ACNGT 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 8
BstBAI YACGTR 1 cut(s) 70
BstF5I GGATG 1 cut(s) 82
BstNI CCWGG 2 cut(s) 85, 185
BstSCI CCNGG 2 cut(s) 83, 183
BstSFI CTRYAG 1 cut(s) 5
BsuRI GGCC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 82
CciI TCATGA 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 188
CviAII CATG 1 cut(s) 37
CviJI RGCY 3 cut(s) 82, 94, 190
CviKI_1 RGCY 3 cut(s) 82, 94, 190
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
Eco24I GRGCYC 1 cut(s) 84
Eco32I GATATC 1 cut(s) 151
EcoO109I RGGNCCY 1 cut(s) 188
EcoRII CCWGG 2 cut(s) 83, 183
EcoRV GATATC 1 cut(s) 151
EcoT38I GRGCYC 1 cut(s) 84
FaeI CATG 1 cut(s) 40
FaiI YATR 2 cut(s) 38, 116
FatI CATG 1 cut(s) 36
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 1 cut(s) 89
FriOI GRGCYC 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 1 cut(s) 190
Hin1II CATG 1 cut(s) 40
HindIII AAGCTT 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 37, 163
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 7, 47
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 1 cut(s) 40
LpnPI CCDG 6 cut(s) 70, 97, 159, 170, 191, 197
LweI GCATC 1 cut(s) 34
MaeII ACGT 1 cut(s) 69
MaeIII GTNAC 2 cut(s) 101, 179
MboII GAAGA 1 cut(s) 25
MhlI GDGCHC 1 cut(s) 84
MluCI AATT 2 cut(s) 31, 155
MspR9I CCNGG 2 cut(s) 85, 185
MvaI CCWGG 2 cut(s) 85, 185
NlaIII CATG 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 189
NmuCI GTSAC 1 cut(s) 101
PagI TCATGA 1 cut(s) 36
PflFI GACNNNGTC 1 cut(s) 25
PkrI GCNGC 1 cut(s) 6
Ppu21I YACGTR 1 cut(s) 70
Psp6I CCWGG 2 cut(s) 83, 183
PspGI CCWGG 2 cut(s) 83, 183
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 188
PstI CTGCAG 1 cut(s) 9
PsyI GACNNNGTC 1 cut(s) 25
SatI GCNGC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 188
ScrFI CCNGG 2 cut(s) 85, 185
SduI GDGCHC 1 cut(s) 84
SetI ASST 3 cut(s) 72, 96, 186
SfaNI GCATC 1 cut(s) 34
SfcI CTRYAG 1 cut(s) 5
Sse9I AATT 2 cut(s) 31, 155
StyD4I CCNGG 2 cut(s) 83, 183
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 1 cut(s) 72
TaqI TCGA 1 cut(s) 153
TasI AATT 2 cut(s) 31, 155
TseFI GTSAC 1 cut(s) 101
TseI GCWGC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 25
Tth111I GACNNNGTC 1 cut(s) 25
XapI RAATTY 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.