pycom08g10970

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0017632
Physical Location & Seq
Forward (+)
9221622 .. 9222080
459 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g10970.1

Sequence Viewer

Length: 459 bp
ATGACACGGGATGCTTTGCTTCTATCGCCACCGCTAACTCGGCCTCCGCCTCGCGAGAGGCGCAGGGTAGGCGAGGTGGCCGGCGGCGCCGCGGCGGAGTGCGCGGCGGTGTGCTGCTGCTGCCCGTTCAGCGTGATGAATTTACTGATATTGACGGTGTACAAAGTCCCGAAAGGTATTTGCAGGAGGGCCTTGGCCCACAGGAGGAACAAGCGGCGGTGCTTGGCGGCCCAGAAGAAGGCGCTGTTGCAGCCCAGGCCCAATGGGCTCGCCGGCGGCGGGCTTTATAGCGACGACGACGAATTCTTGAGGAGAGCGAGCAGCTACAGCGACGGCGACGTAGATGACCGAAAGGGCAGCGAGGATGAATCGGAGGGCGCTGATTTGTTGGAGAAGGAGATGTGGGACCGATTCGATGGTGCCGGCTTTTGGAGGAGTGCTTCTCGGAGAGATTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

153

Amino Acids

16.84

Weight (kDa)

8.93

Isoelectric Point (pI)

66.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017632)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g26780
malus_domestica MD03G1160300.v1.1 MD15G1108700.v1.1
prunus_persica Prupe.6G148600_v2.0.a1
pyrus_communis pycom03g11280 pycom08g10970 pycom15g09930
rosa_chinensis RchiOBHm_Chr5g0049201
rosa_rugosa Rorug05G0245700
rosa_samantha Rh5BG334000 Rh5DG346100
rosa_wichuraiana Rw5G030560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 86, 419
AccII CGCG 3 cut(s) 54, 92, 104
AcoI YGGCCR 1 cut(s) 78
AcsI RAATTY 2 cut(s) 139, 302
AcyI GRCGYC 1 cut(s) 87
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 4 cut(s) 204, 238, 279, 429
AjnI CCWGG 1 cut(s) 254
AluBI AGCT 1 cut(s) 324
AluI AGCT 1 cut(s) 324
AoxI GGCC 6 cut(s) 41, 78, 189, 195, 228, 257
ApeKI GCWGC 6 cut(s) 114, 117, 120, 250, 321, 357
ApoI RAATTY 2 cut(s) 139, 302
AspLEI GCGC 5 cut(s) 63, 89, 104, 244, 380
AspS9I GGNCC 5 cut(s) 189, 196, 229, 258, 406
AvaII GGWCC 1 cut(s) 406
BanI GGYRCC 2 cut(s) 86, 419
BanII GRGCYC 1 cut(s) 270
BbvI GCAGC 6 cut(s) 101, 104, 107, 262, 333, 369
BccI CCATC 1 cut(s) 410
BceAI ACGGC 1 cut(s) 349
BciT130I CCWGG 1 cut(s) 256
BfmI CTRYAG 1 cut(s) 325
BfoI RGCGCY 3 cut(s) 90, 245, 381
BglI GCCNNNNNGGC 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 256
Bme18I GGWCC 1 cut(s) 406
BmgT120I GGNCC 5 cut(s) 189, 196, 229, 258, 406
BmiI GGNNCC 3 cut(s) 88, 407, 421
BmrFI CCNGG 1 cut(s) 256
BplI GAGNNNNNCTC 2 cut(s) 427, 459
BpuEI CTTGAG 1 cut(s) 328
BsaHI GRCGYC 1 cut(s) 87
BsaJI CCNNGG 3 cut(s) 90, 192, 254
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bsc4I CCNNNNNNNGG 4 cut(s) 204, 238, 279, 429
Bse118I RCCGGY 3 cut(s) 80, 272, 422
BseBI CCWGG 1 cut(s) 256
BseDI CCNNGG 3 cut(s) 90, 192, 254
BseGI GGATG 2 cut(s) 16, 370
BseLI CCNNNNNNNGG 4 cut(s) 204, 238, 279, 429
BseRI GAGGAG 2 cut(s) 325, 448
BseXI GCAGC 6 cut(s) 101, 104, 107, 262, 333, 369
Bsh1236I CGCG 3 cut(s) 54, 92, 104
BshFI GGCC 6 cut(s) 43, 80, 191, 197, 230, 259
BshNI GGYRCC 2 cut(s) 86, 419
BsiSI CCGG 3 cut(s) 81, 273, 423
BslFI GGGAC 2 cut(s) 152, 419
BslI CCNNNNNNNGG 4 cut(s) 204, 238, 279, 429
BsmFI GGGAC 2 cut(s) 152, 419
BsnI GGCC 6 cut(s) 43, 80, 191, 197, 230, 259
Bsp1286I GDGCHC 1 cut(s) 270
Bsp1407I TGTACA 1 cut(s) 159
Bsp68I TCGCGA 1 cut(s) 54
BspANI GGCC 6 cut(s) 43, 80, 191, 197, 230, 259
BspFNI CGCG 3 cut(s) 54, 92, 104
BspLI GGNNCC 3 cut(s) 88, 407, 421
BspT107I GGYRCC 2 cut(s) 86, 419
BsrFI RCCGGY 3 cut(s) 80, 272, 422
BsrGI TGTACA 1 cut(s) 159
BssAI RCCGGY 3 cut(s) 80, 272, 422
BssECI CCNNGG 3 cut(s) 90, 192, 254
BssNI GRCGYC 1 cut(s) 87
BssT1I CCWWGG 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 157
BstACI GRCGYC 1 cut(s) 87
BstAUI TGTACA 1 cut(s) 159
BstC8I GCNNGC 6 cut(s) 82, 270, 274, 281, 319, 424
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 2 cut(s) 16, 370
BstFNI CGCG 3 cut(s) 54, 92, 104
BstH2I RGCGCY 3 cut(s) 90, 245, 381
BstHHI GCGC 5 cut(s) 63, 89, 104, 244, 380
BstNI CCWGG 1 cut(s) 256
BstSCI CCNGG 1 cut(s) 254
BstSFI CTRYAG 1 cut(s) 325
BstUI CGCG 3 cut(s) 54, 92, 104
BstV1I GCAGC 6 cut(s) 101, 104, 107, 262, 333, 369
BsuRI GGCC 6 cut(s) 43, 80, 191, 197, 230, 259
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 2 cut(s) 16, 370
BtuMI TCGCGA 1 cut(s) 54
Cac8I GCNNGC 6 cut(s) 82, 270, 274, 281, 319, 424
CfoI GCGC 5 cut(s) 63, 89, 104, 244, 380
Cfr10I RCCGGY 3 cut(s) 80, 272, 422
Cfr13I GGNCC 5 cut(s) 189, 196, 229, 258, 406
Cfr42I CCGCGG 1 cut(s) 93
Csp6I GTAC 1 cut(s) 160
CviQI GTAC 1 cut(s) 160
DinI GGCGCC 1 cut(s) 88
EaeI YGGCCR 1 cut(s) 78
EciI GGCGGA 2 cut(s) 36, 110
Eco130I CCWWGG 1 cut(s) 192
Eco24I GRGCYC 1 cut(s) 270
Eco47I GGWCC 1 cut(s) 406
EcoO109I RGGNCCY 1 cut(s) 189
EcoRI GAATTC 1 cut(s) 302
EcoRII CCWGG 1 cut(s) 254
EcoT14I CCWWGG 1 cut(s) 192
EcoT38I GRGCYC 1 cut(s) 270
EgeI GGCGCC 1 cut(s) 88
EheI GGCGCC 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 192
FaiI YATR 1 cut(s) 288
FaqI GGGAC 2 cut(s) 152, 419
FauI CCCGC 1 cut(s) 272
FokI GGATG 2 cut(s) 23, 377
FriOI GRGCYC 1 cut(s) 270
GlaI GCGC 5 cut(s) 62, 88, 103, 243, 379
HaeII RGCGCY 3 cut(s) 90, 245, 381
HaeIII GGCC 6 cut(s) 43, 80, 191, 197, 230, 259
HapII CCGG 3 cut(s) 81, 273, 423
HhaI GCGC 5 cut(s) 63, 89, 104, 244, 380
Hin1I GRCGYC 1 cut(s) 87
Hin6I GCGC 5 cut(s) 61, 87, 102, 242, 378
HinP1I GCGC 5 cut(s) 61, 87, 102, 242, 378
HinfI GANTC 2 cut(s) 368, 411
HpaII CCGG 3 cut(s) 81, 273, 423
Hpy166II GTNNAC 1 cut(s) 160
Hpy188I TCNGA 2 cut(s) 373, 447
Hpy188III TCNNGA 3 cut(s) 53, 169, 307
Hpy8I GTNNAC 1 cut(s) 160
Hpy99I CGWCG 5 cut(s) 296, 299, 302, 335, 341
HpyAV CCTTC 2 cut(s) 232, 388
HpyCH4III ACNGT 1 cut(s) 157
HpyCH4IV ACGT 1 cut(s) 339
HpyCH4V TGCA 2 cut(s) 183, 250
HpySE526I ACGT 1 cut(s) 339
Hsp92I GRCGYC 1 cut(s) 87
HspAI GCGC 5 cut(s) 61, 87, 102, 242, 378
KasI GGCGCC 1 cut(s) 86
KroI GCCGGC 3 cut(s) 80, 272, 422
KroNI GCCGGC 3 cut(s) 82, 274, 424
KspI CCGCGG 1 cut(s) 93
LpnPI CCDG 9 cut(s) 49, 94, 169, 187, 241, 245, 268, 286, 436
Lsp1109I GCAGC 6 cut(s) 101, 104, 107, 262, 333, 369
MaeII ACGT 1 cut(s) 339
MboII GAAGA 1 cut(s) 247
MhlI GDGCHC 1 cut(s) 270
MluCI AATT 2 cut(s) 139, 302
Mly113I GGCGCC 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 369
MreI CGCCGGCG 1 cut(s) 272
MroNI GCCGGC 3 cut(s) 80, 272, 422
MspA1I CMGCKG 1 cut(s) 92
MspI CCGG 3 cut(s) 81, 273, 423
MspR9I CCNGG 1 cut(s) 256
MvaI CCWGG 1 cut(s) 256
MvnI CGCG 3 cut(s) 54, 92, 104
NaeI GCCGGC 3 cut(s) 82, 274, 424
NarI GGCGCC 1 cut(s) 87
NgoMIV GCCGGC 3 cut(s) 80, 272, 422
NlaIV GGNNCC 3 cut(s) 88, 407, 421
NmeAIII GCCGAG 1 cut(s) 19
NruI TCGCGA 1 cut(s) 54
PdiI GCCGGC 3 cut(s) 82, 274, 424
PfeI GAWTC 2 cut(s) 368, 411
PluTI GGCGCC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 254
PspGI CCWGG 1 cut(s) 254
PspN4I GGNNCC 3 cut(s) 88, 407, 421
PspPI GGNCC 5 cut(s) 189, 196, 229, 258, 406
RruI TCGCGA 1 cut(s) 54
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SacII CCGCGG 1 cut(s) 93
Sau96I GGNCC 5 cut(s) 189, 196, 229, 258, 406
ScrFI CCNGG 1 cut(s) 256
SduI GDGCHC 1 cut(s) 270
SetI ASST 4 cut(s) 78, 178, 326, 342
SfcI CTRYAG 1 cut(s) 325
SfoI GGCGCC 1 cut(s) 88
Sfr303I CCGCGG 1 cut(s) 93
SgrAI CRCCGGYG 1 cut(s) 272
SgrBI CCGCGG 1 cut(s) 93
SinI GGWCC 1 cut(s) 406
SmlI CTYRAG 1 cut(s) 307
SmoI CTYRAG 1 cut(s) 307
Sse9I AATT 2 cut(s) 139, 302
SspDI GGCGCC 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 254
StyI CCWWGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 157
TaiI ACGT 1 cut(s) 342
TaqI TCGA 1 cut(s) 414
TaqII GACCGA 2 cut(s) 363, 423
TasI AATT 2 cut(s) 139, 302
TatI WGTACW 1 cut(s) 159
TauI GCSGC 7 cut(s) 87, 92, 95, 107, 217, 230, 279
TfiI GAWTC 2 cut(s) 368, 411
TseI GCWGC 6 cut(s) 114, 117, 120, 250, 321, 357
TspDTI ATGAA 2 cut(s) 152, 381
VpaK11BI GGWCC 1 cut(s) 406
XapI RAATTY 2 cut(s) 139, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.