pycom10g28400

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
29011432 .. 29012479
1048 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g28400.4

Sequence Viewer

Length: 384 bp
ATGTATCTCGGAACCTTGGATCTATCGCAAAATCAACTCAGTGGTCCAATACCAGCAAGCTTAGGGGGCTTGGTTTCTCTTCGATATTTATATCTGCAATACAACTTGCTTAGCGGAGGTATACCACGAAATTTTGGTTCACTGACGAAGCTTACTGAATTATATCTGCAGTTTAATATGCTATCAGGCACAATTCCTGAGGGTTTTGGAGATCTTTCGCTTCTTACAACTATGGATCTGTCTGAGAATCAGCTCTCTGGTCCTCTTCCAGAAAGCCTCGGAAAGTTGAAATCACTCACAACCTTCCTTGTGTCGGCCAATTATTTGAGTGAGAAATTTCCAAATACTTCTTATGGCAACCTCACAAGCCTGAAAAAGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

13.82

Weight (kDa)

6.15

Isoelectric Point (pI)

23.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 121
AciI CCGC 1 cut(s) 114
AclWI GGATC 2 cut(s) 27, 243
AcoI YGGCCR 1 cut(s) 315
AcsI RAATTY 2 cut(s) 130, 335
AfiI CCNNNNNNNGG 1 cut(s) 313
AgsI TTSAA 1 cut(s) 289
AluBI AGCT 3 cut(s) 60, 151, 253
AluI AGCT 3 cut(s) 60, 151, 253
AlwI GGATC 2 cut(s) 27, 243
AoxI GGCC 1 cut(s) 315
ApoI RAATTY 2 cut(s) 130, 335
AspS9I GGNCC 2 cut(s) 44, 260
AvaII GGWCC 2 cut(s) 44, 260
AxyI CCTNAGG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 167
BglII AGATCT 1 cut(s) 211
BlpI GCTNAGC 1 cut(s) 110
Bme18I GGWCC 2 cut(s) 44, 260
BmgT120I GGNCC 2 cut(s) 44, 260
BmiI GGNNCC 1 cut(s) 13
Bpu10I CCTNAGC 1 cut(s) 61
Bpu1102I GCTNAGC 1 cut(s) 110
BsaJI CCNNGG 2 cut(s) 15, 277
Bsc4I CCNNNNNNNGG 1 cut(s) 313
Bse21I CCTNAGG 1 cut(s) 198
BseDI CCNNGG 2 cut(s) 15, 277
BseLI CCNNNNNNNGG 1 cut(s) 313
BseMII CTCAG 3 cut(s) 52, 189, 234
BshFI GGCC 1 cut(s) 317
BslI CCNNNNNNNGG 1 cut(s) 313
BsnI GGCC 1 cut(s) 317
Bsp143I GATC 3 cut(s) 19, 211, 235
Bsp1720I GCTNAGC 1 cut(s) 110
BspACI CCGC 1 cut(s) 114
BspANI GGCC 1 cut(s) 317
BspCNI CTCAG 3 cut(s) 51, 190, 235
BspLI GGNNCC 1 cut(s) 13
BspMAI CTGCAG 1 cut(s) 171
BspPI GGATC 2 cut(s) 27, 243
BssECI CCNNGG 2 cut(s) 15, 277
BssMI GATC 3 cut(s) 19, 211, 235
BssNAI GTATAC 1 cut(s) 122
BssT1I CCWWGG 1 cut(s) 15
Bst1107I GTATAC 1 cut(s) 122
Bst6I CTCTTC 2 cut(s) 84, 270
BstC8I GCNNGC 1 cut(s) 58
BstDEI CTNAG 5 cut(s) 38, 61, 110, 198, 243
BstKTI GATC 3 cut(s) 22, 214, 238
BstMBI GATC 3 cut(s) 19, 211, 235
BstMWI GCNNNNNNNGC 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 167
BstX2I RGATCY 3 cut(s) 19, 211, 235
BstYI RGATCY 3 cut(s) 19, 211, 235
BstZ17I GTATAC 1 cut(s) 122
Bsu36I CCTNAGG 1 cut(s) 198
BsuRI GGCC 1 cut(s) 317
BtsIMutI CAGTG 2 cut(s) 46, 140
Cac8I GCNNGC 1 cut(s) 58
Cfr13I GGNCC 2 cut(s) 44, 260
CviJI RGCY 7 cut(s) 60, 69, 151, 253, 276, 317, 369
CviKI_1 RGCY 7 cut(s) 60, 69, 151, 253, 276, 317, 369
DdeI CTNAG 5 cut(s) 38, 61, 110, 198, 243
DpnI GATC 3 cut(s) 21, 213, 237
DpnII GATC 3 cut(s) 19, 211, 235
EaeI YGGCCR 1 cut(s) 315
Eam1104I CTCTTC 2 cut(s) 84, 270
EarI CTCTTC 2 cut(s) 84, 270
Eco130I CCWWGG 1 cut(s) 15
Eco47I GGWCC 2 cut(s) 44, 260
Eco81I CCTNAGG 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 15
ErhI CCWWGG 1 cut(s) 15
FaiI YATR 6 cut(s) 91, 122, 163, 179, 233, 354
FblI GTMKAC 1 cut(s) 121
HaeIII GGCC 1 cut(s) 317
HindIII AAGCTT 2 cut(s) 58, 149
HinfI GANTC 1 cut(s) 247
Hpy166II GTNNAC 2 cut(s) 122, 140
Hpy188I TCNGA 3 cut(s) 11, 244, 281
Hpy188III TCNNGA 2 cut(s) 197, 269
Hpy8I GTNNAC 2 cut(s) 122, 140
HpyAV CCTTC 1 cut(s) 313
HpyCH4V TGCA 2 cut(s) 97, 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 66
HpyF3I CTNAG 5 cut(s) 38, 61, 110, 198, 243
Kzo9I GATC 3 cut(s) 19, 211, 235
LpnPI CCDG 5 cut(s) 66, 171, 210, 243, 282
MalI GATC 3 cut(s) 21, 213, 237
MboI GATC 3 cut(s) 19, 211, 235
MboII GAAGA 2 cut(s) 71, 257
MflI RGATCY 3 cut(s) 19, 211, 235
MluCI AATT 5 cut(s) 130, 158, 192, 319, 335
MnlI CCTC 5 cut(s) 110, 193, 273, 287, 371
MseI TTAA 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 66
NdeII GATC 3 cut(s) 19, 211, 235
NlaIV GGNNCC 1 cut(s) 13
PfeI GAWTC 1 cut(s) 247
PspN4I GGNNCC 1 cut(s) 13
PspPI GGNCC 2 cut(s) 44, 260
PstI CTGCAG 1 cut(s) 171
PsuI RGATCY 3 cut(s) 19, 211, 235
SaqAI TTAA 1 cut(s) 174
Sau3AI GATC 3 cut(s) 19, 211, 235
Sau96I GGNCC 2 cut(s) 44, 260
SetI ASST 7 cut(s) 17, 62, 121, 153, 255, 305, 363
SfcI CTRYAG 1 cut(s) 167
SinI GGWCC 2 cut(s) 44, 260
Sse9I AATT 5 cut(s) 130, 158, 192, 319, 335
SsiI CCGC 1 cut(s) 114
StyI CCWWGG 1 cut(s) 15
TaqI TCGA 1 cut(s) 82
TasI AATT 5 cut(s) 130, 158, 192, 319, 335
TfiI GAWTC 1 cut(s) 247
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 2 cut(s) 46, 147
TspRI CASTG 2 cut(s) 46, 147
VpaK11BI GGWCC 2 cut(s) 44, 260
XapI RAATTY 2 cut(s) 130, 335
XmiI GTMKAC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.