RLG00000000735

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
4582011 .. 4582697
687 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000735

Sequence Viewer

Length: 687 bp
ATGGAGATAGGAAACCTGAAATCATTGGTGGGTCTAGACTTGAGCGCCAATCAACTCAGTGGTTCAATTCCGACAACACTGGGGGATCTGACAAACCTTACTATTCTTTCCCTCTTTACAAATAATCTTTCTGGCACTATTCCCATGGAGATAGGAAACCTCAAATCATTGGTGGCTCTACGGTTGAGCACAAATCTCCTCAGTGGTTCAATTCAGACAACACTGGGGGATCTGAAGAACCTTACCACTCTCTATCTCCATGCAAATAATCTTTCTGGCACTATTCCCGTGGAGATAGGAAACCTGAAATCATTGGTGGCTCTATGGTTGGGCACAAATCGCCTAAGTGGTTCAATTCCGACAACACTGGGGGATCTGAAGAACCTTACCACTCTCTATCTCCATACAAATAATCTTTCTGGCACTATTCCCATGGAAATAGGAAACCTGAAATCATTGGTGGGTCTAGACTTGAGCGCCAATCAACTCAGTGGTTCAATTCCGACAACACTGGGGGATCTGACAAACCTTACTATTCTTTCCCTCTTTACAAATAATCTTTCTGGCACTATTCCCATGGAGATAGGAAACCTGAAATCATTGGTGAATCTAAGCTTGAGCGCCAATCAACACAGTGGTTCAATTCCGACAACATTAGGTGGTCTGACCAACCTTACCACTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

229

Amino Acids

23.77

Weight (kDa)

5.83

Isoelectric Point (pI)

4.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 2 - 88 2.3e-09 Leucine-rich repeat region
LRR_14 PF23598 133 - 228 8e-12 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 93, 237, 381, 525
AcuI CTGAAG 2 cut(s) 254, 398
AgsI TTSAA 5 cut(s) 66, 210, 354, 498, 642
AluBI AGCT 1 cut(s) 615
AluI AGCT 1 cut(s) 615
Alw21I GWGCWC 1 cut(s) 191
AlwI GGATC 4 cut(s) 93, 237, 381, 525
AspLEI GCGC 3 cut(s) 47, 479, 623
AsuHPI GGTGA 1 cut(s) 616
BaeGI GKGCMC 1 cut(s) 335
Bbv12I GWGCWC 1 cut(s) 191
BfaI CTAG 2 cut(s) 35, 467
BfoI RGCGCY 3 cut(s) 48, 480, 624
BmrI ACTGGG 4 cut(s) 89, 233, 377, 521
BmuI ACTGGG 4 cut(s) 89, 233, 377, 521
BpuEI CTTGAG 3 cut(s) 61, 493, 637
BsaJI CCNNGG 4 cut(s) 144, 288, 432, 576
Bse1I ACTGG 4 cut(s) 84, 228, 372, 516
BseDI CCNNGG 4 cut(s) 144, 288, 432, 576
BseMII CTCAG 3 cut(s) 70, 214, 502
BseNI ACTGG 4 cut(s) 84, 228, 372, 516
BseRI GAGGAG 1 cut(s) 188
BseSI GKGCMC 1 cut(s) 335
BsiHKAI GWGCWC 1 cut(s) 191
Bsp1286I GDGCHC 2 cut(s) 191, 335
Bsp143I GATC 4 cut(s) 85, 229, 373, 517
Bsp19I CCATGG 3 cut(s) 144, 432, 576
BspCNI CTCAG 3 cut(s) 69, 213, 501
BspPI GGATC 4 cut(s) 93, 237, 381, 525
BsrI ACTGG 4 cut(s) 84, 228, 372, 516
BssECI CCNNGG 4 cut(s) 144, 288, 432, 576
BssMI GATC 4 cut(s) 85, 229, 373, 517
BssT1I CCWWGG 3 cut(s) 144, 432, 576
Bst4CI ACNGT 2 cut(s) 183, 635
BstDEI CTNAG 5 cut(s) 56, 200, 344, 488, 611
BstDSI CCRYGG 4 cut(s) 144, 288, 432, 576
BstH2I RGCGCY 3 cut(s) 48, 480, 624
BstHHI GCGC 3 cut(s) 47, 479, 623
BstKTI GATC 4 cut(s) 88, 232, 376, 520
BstMBI GATC 4 cut(s) 85, 229, 373, 517
BstMWI GCNNNNNNNGC 1 cut(s) 339
BstSLI GKGCMC 1 cut(s) 335
BstX2I RGATCY 4 cut(s) 85, 229, 373, 517
BstYI RGATCY 4 cut(s) 85, 229, 373, 517
BtgI CCRYGG 4 cut(s) 144, 288, 432, 576
BtsIMutI CAGTG 8 cut(s) 64, 77, 208, 221, 365, 496, 509, 640
CfoI GCGC 3 cut(s) 47, 479, 623
CviAII CATG 4 cut(s) 145, 260, 433, 577
CviJI RGCY 3 cut(s) 176, 320, 615
CviKI_1 RGCY 3 cut(s) 176, 320, 615
DdeI CTNAG 5 cut(s) 56, 200, 344, 488, 611
DpnI GATC 4 cut(s) 87, 231, 375, 519
DpnII GATC 4 cut(s) 85, 229, 373, 517
Eco130I CCWWGG 3 cut(s) 144, 432, 576
Eco57I CTGAAG 2 cut(s) 254, 398
EcoT14I CCWWGG 3 cut(s) 144, 432, 576
ErhI CCWWGG 3 cut(s) 144, 432, 576
FaeI CATG 4 cut(s) 148, 263, 436, 580
FaiI YATR 6 cut(s) 146, 261, 325, 405, 434, 578
FatI CATG 4 cut(s) 144, 259, 432, 576
FspBI CTAG 2 cut(s) 35, 467
GlaI GCGC 3 cut(s) 46, 478, 622
HaeII RGCGCY 3 cut(s) 48, 480, 624
HhaI GCGC 3 cut(s) 47, 479, 623
Hin1II CATG 4 cut(s) 148, 263, 436, 580
Hin6I GCGC 3 cut(s) 45, 477, 621
HinP1I GCGC 3 cut(s) 45, 477, 621
HindIII AAGCTT 1 cut(s) 613
HinfI GANTC 1 cut(s) 607
HphI GGTGA 1 cut(s) 616
Hpy188III TCNNGA 2 cut(s) 35, 467
HpyCH4III ACNGT 2 cut(s) 183, 635
HpyCH4V TGCA 1 cut(s) 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 339
HpyF3I CTNAG 5 cut(s) 56, 200, 344, 488, 611
Hsp92II CATG 4 cut(s) 148, 263, 436, 580
HspAI GCGC 3 cut(s) 45, 477, 621
Kzo9I GATC 4 cut(s) 85, 229, 373, 517
MaeI CTAG 2 cut(s) 35, 467
MalI GATC 4 cut(s) 87, 231, 375, 519
MboI GATC 4 cut(s) 85, 229, 373, 517
MboII GAAGA 2 cut(s) 247, 391
MflI RGATCY 4 cut(s) 85, 229, 373, 517
MhlI GDGCHC 2 cut(s) 191, 335
MluCI AATT 5 cut(s) 66, 210, 354, 498, 642
MmeI TCCRAC 4 cut(s) 95, 383, 527, 671
MnlI CCTC 4 cut(s) 122, 170, 209, 554
MwoI GCNNNNNNNGC 1 cut(s) 339
NcoI CCATGG 3 cut(s) 144, 432, 576
NdeII GATC 4 cut(s) 85, 229, 373, 517
NlaIII CATG 4 cut(s) 148, 263, 436, 580
PfeI GAWTC 1 cut(s) 607
PsuI RGATCY 4 cut(s) 85, 229, 373, 517
Sau3AI GATC 4 cut(s) 85, 229, 373, 517
SduI GDGCHC 2 cut(s) 191, 335
SmlI CTYRAG 3 cut(s) 40, 472, 616
SmoI CTYRAG 3 cut(s) 40, 472, 616
Sse9I AATT 5 cut(s) 66, 210, 354, 498, 642
SspMI CTAG 2 cut(s) 35, 467
StyI CCWWGG 3 cut(s) 144, 432, 576
TaaI ACNGT 2 cut(s) 183, 635
TasI AATT 5 cut(s) 66, 210, 354, 498, 642
TfiI GAWTC 1 cut(s) 607
TscAI CASTG 8 cut(s) 64, 84, 208, 228, 372, 496, 516, 640
TspRI CASTG 8 cut(s) 64, 84, 208, 228, 372, 496, 516, 640
XbaI TCTAGA 2 cut(s) 34, 466
XspI CTAG 2 cut(s) 35, 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.