Rmu_sc0000063.1_g000037

LRR receptor-like serine threonine-protein kinase At4g08850

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000063.1
OG0017734
Physical Location & Seq
Reverse (-)
179236 .. 180495
1260 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000063.1_g000037.1.cds

Sequence Viewer

Length: 1260 bp
atggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaagttgaaatcattggtgaatctaagcttaagcaacaatcacctcagtggttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataatctttctggcactattcccatggagataggaaacctgaaatcattggtgaatctaagcttcagcaccaatcaactcagtggttcaattccgataacactgggggatctgaccaaccttaccactctctatctctttgaaaataatctttctggccctattcctatggagataggaaacttgaaatcattggtgaatctattcttgagcaccaatcaactcaagggttcaattccgacaacactgggggatctgaccaaccttaccattctctccctccattcaaataatctttctggcactattcctatggagataggaaacctgaaatcattggtggatttacggttgaagttcagttccgtcaacactaggggatcttacgaaccttaccactctctatctccatataaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase RVT_2

Protein Analysis

419

Amino Acids

44.68

Weight (kDa)

7.27

Isoelectric Point (pI)

15.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 9 cut(s) 93, 237, 381, 525, 669, 813, 957, 1101, 1228
AcuI CTGAAG 1 cut(s) 889
AflII CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
AleI CACNNNNGTG 6 cut(s) 57, 201, 345, 489, 633, 777
AluBI AGCT 7 cut(s) 39, 183, 327, 471, 615, 759, 903
AluI AGCT 7 cut(s) 39, 183, 327, 471, 615, 759, 903
Alw21I GWGCWC 1 cut(s) 1055
AlwI GGATC 9 cut(s) 93, 237, 381, 525, 669, 813, 957, 1101, 1228
AoxI GGCC 1 cut(s) 997
Asp700I GAANNNNTTC 1 cut(s) 1043
AspS9I GGNCC 1 cut(s) 998
Bbv12I GWGCWC 1 cut(s) 1055
BfaI CTAG 7 cut(s) 80, 224, 368, 512, 656, 800, 1215
BfrI CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
BmgT120I GGNCC 1 cut(s) 998
BmrI ACTGGG 2 cut(s) 953, 1097
BmuI ACTGGG 2 cut(s) 953, 1097
BpuEI CTTGAG 2 cut(s) 1049, 1069
BsaJI CCNNGG 6 cut(s) 144, 288, 432, 576, 720, 864
Bse1I ACTGG 2 cut(s) 948, 1092
BseDI CCNNGG 6 cut(s) 144, 288, 432, 576, 720, 864
BseMII CTCAG 7 cut(s) 70, 214, 358, 502, 646, 790, 934
BseNI ACTGG 2 cut(s) 948, 1092
BshFI GGCC 1 cut(s) 999
BsiHKAI GWGCWC 1 cut(s) 1055
BsnI GGCC 1 cut(s) 999
Bsp1286I GDGCHC 1 cut(s) 1055
Bsp143I GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
Bsp19I CCATGG 6 cut(s) 144, 288, 432, 576, 720, 864
BspANI GGCC 1 cut(s) 999
BspCNI CTCAG 7 cut(s) 69, 213, 357, 501, 645, 789, 933
BspPI GGATC 9 cut(s) 93, 237, 381, 525, 669, 813, 957, 1101, 1228
BspTI CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
BsrI ACTGG 2 cut(s) 948, 1092
BssECI CCNNGG 6 cut(s) 144, 288, 432, 576, 720, 864
BssMI GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
BssT1I CCWWGG 6 cut(s) 144, 288, 432, 576, 720, 864
Bst4CI ACNGT 1 cut(s) 1191
BstAFI CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
BstDSI CCRYGG 6 cut(s) 144, 288, 432, 576, 720, 864
BstKTI GATC 9 cut(s) 88, 232, 376, 520, 664, 808, 952, 1096, 1223
BstMBI GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
BstX2I RGATCY 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
BstYI RGATCY 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
BsuRI GGCC 1 cut(s) 999
BtgI CCRYGG 6 cut(s) 144, 288, 432, 576, 720, 864
BtsIMutI CAGTG 9 cut(s) 64, 208, 352, 496, 640, 784, 928, 941, 1085
Cfr13I GGNCC 1 cut(s) 998
CviAII CATG 6 cut(s) 145, 289, 433, 577, 721, 865
CviJI RGCY 8 cut(s) 39, 183, 327, 471, 615, 759, 903, 999
CviKI_1 RGCY 8 cut(s) 39, 183, 327, 471, 615, 759, 903, 999
DpnI GATC 9 cut(s) 87, 231, 375, 519, 663, 807, 951, 1095, 1222
DpnII GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
Eco130I CCWWGG 6 cut(s) 144, 288, 432, 576, 720, 864
Eco57I CTGAAG 1 cut(s) 889
EcoT14I CCWWGG 6 cut(s) 144, 288, 432, 576, 720, 864
ErhI CCWWGG 6 cut(s) 144, 288, 432, 576, 720, 864
FaeI CATG 6 cut(s) 148, 292, 436, 580, 724, 868
FatI CATG 6 cut(s) 144, 288, 432, 576, 720, 864
FspBI CTAG 7 cut(s) 80, 224, 368, 512, 656, 800, 1215
HaeIII GGCC 1 cut(s) 999
Hin1II CATG 6 cut(s) 148, 292, 436, 580, 724, 868
HincII GTYRAC 7 cut(s) 75, 219, 363, 507, 651, 795, 1210
HindII GTYRAC 7 cut(s) 75, 219, 363, 507, 651, 795, 1210
HindIII AAGCTT 7 cut(s) 37, 181, 325, 469, 613, 757, 901
HinfI GANTC 8 cut(s) 31, 175, 319, 463, 607, 751, 895, 1039
Hpy166II GTNNAC 7 cut(s) 75, 219, 363, 507, 651, 795, 1210
Hpy188I TCNGA 4 cut(s) 936, 954, 1080, 1098
Hpy188III TCNNGA 1 cut(s) 1048
Hpy8I GTNNAC 7 cut(s) 75, 219, 363, 507, 651, 795, 1210
HpyCH4III ACNGT 1 cut(s) 1191
Hsp92II CATG 6 cut(s) 148, 292, 436, 580, 724, 868
Kzo9I GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
MaeI CTAG 7 cut(s) 80, 224, 368, 512, 656, 800, 1215
MalI GATC 9 cut(s) 87, 231, 375, 519, 663, 807, 951, 1095, 1222
MboI GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
MflI RGATCY 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
MhlI GDGCHC 1 cut(s) 1055
MluCI AATT 2 cut(s) 930, 1074
MmeI TCCRAC 1 cut(s) 1103
MnlI CCTC 7 cut(s) 65, 209, 353, 497, 641, 785, 1130
MroXI GAANNNNTTC 1 cut(s) 1043
MseI TTAA 6 cut(s) 41, 185, 329, 473, 617, 761
MslI CAYNNNNRTG 6 cut(s) 57, 201, 345, 489, 633, 777
MspCI CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
NcoI CCATGG 6 cut(s) 144, 288, 432, 576, 720, 864
NdeII GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
NlaIII CATG 6 cut(s) 148, 292, 436, 580, 724, 868
OliI CACNNNNGTG 6 cut(s) 57, 201, 345, 489, 633, 777
PdmI GAANNNNTTC 1 cut(s) 1043
PfeI GAWTC 8 cut(s) 31, 175, 319, 463, 607, 751, 895, 1039
PspPI GGNCC 1 cut(s) 998
PsuI RGATCY 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
RseI CAYNNNNRTG 6 cut(s) 57, 201, 345, 489, 633, 777
SaqAI TTAA 6 cut(s) 41, 185, 329, 473, 617, 761
Sau3AI GATC 9 cut(s) 85, 229, 373, 517, 661, 805, 949, 1093, 1220
Sau96I GGNCC 1 cut(s) 998
SduI GDGCHC 1 cut(s) 1055
SmiMI CAYNNNNRTG 6 cut(s) 57, 201, 345, 489, 633, 777
SmlI CTYRAG 8 cut(s) 40, 184, 328, 472, 616, 760, 1048, 1064
SmoI CTYRAG 8 cut(s) 40, 184, 328, 472, 616, 760, 1048, 1064
Sse9I AATT 2 cut(s) 930, 1074
SspMI CTAG 7 cut(s) 80, 224, 368, 512, 656, 800, 1215
StyI CCWWGG 6 cut(s) 144, 288, 432, 576, 720, 864
TaaI ACNGT 1 cut(s) 1191
TasI AATT 2 cut(s) 930, 1074
TfiI GAWTC 8 cut(s) 31, 175, 319, 463, 607, 751, 895, 1039
Tru1I TTAA 6 cut(s) 41, 185, 329, 473, 617, 761
Tru9I TTAA 6 cut(s) 41, 185, 329, 473, 617, 761
TscAI CASTG 9 cut(s) 64, 208, 352, 496, 640, 784, 928, 948, 1092
TspGWI ACGGA 7 cut(s) 60, 204, 348, 492, 636, 780, 1195
TspRI CASTG 9 cut(s) 64, 208, 352, 496, 640, 784, 928, 948, 1092
Vha464I CTTAAG 6 cut(s) 40, 184, 328, 472, 616, 760
XmnI GAANNNNTTC 1 cut(s) 1043
XspI CTAG 7 cut(s) 80, 224, 368, 512, 656, 800, 1215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.