RLG00000000734

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0017734
Physical Location & Seq
Forward (+)
4581579 .. 4581890
312 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000734

Sequence Viewer

Length: 312 bp
ATGGAGATAGGAAACCTGAAATCATTGGTGGCTCTATGGTTGGGCACAAATCGCCTCAGTGGTTCAATTCCGACAACACTGGGGGATCTGAAGAACCTTACCACTCTCTATCTCCATACAAATAATCTTTCTGGCACTATTCCCATGGAGATAGGAAACCTGAAATCATTGGTGGGTCTAGACTTGAGCGCCAATCAACTCAGTGGTTCAATTCCGACAACACTGGGGGATCTGACAAACCTTACTATTCTTTCCCTCTTTACAAATAATCTTTCTGGCACTATTCCCATGGAGATAGGAAACCTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

10.88

Weight (kDa)

5.56

Isoelectric Point (pI)

1.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 2 - 88 4.3e-10 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 93, 237
AcuI CTGAAG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 66, 210
AlwI GGATC 2 cut(s) 93, 237
AspLEI GCGC 1 cut(s) 191
BaeGI GKGCMC 1 cut(s) 47
BfaI CTAG 1 cut(s) 179
BfoI RGCGCY 1 cut(s) 192
BmrI ACTGGG 2 cut(s) 89, 233
BmuI ACTGGG 2 cut(s) 89, 233
BpuEI CTTGAG 1 cut(s) 205
BsaJI CCNNGG 2 cut(s) 144, 288
Bse1I ACTGG 2 cut(s) 84, 228
BseDI CCNNGG 2 cut(s) 144, 288
BseMII CTCAG 2 cut(s) 70, 214
BseNI ACTGG 2 cut(s) 84, 228
BseSI GKGCMC 1 cut(s) 47
Bsp1286I GDGCHC 1 cut(s) 47
Bsp143I GATC 2 cut(s) 85, 229
Bsp19I CCATGG 2 cut(s) 144, 288
BspCNI CTCAG 2 cut(s) 69, 213
BspPI GGATC 2 cut(s) 93, 237
BsrI ACTGG 2 cut(s) 84, 228
BssECI CCNNGG 2 cut(s) 144, 288
BssMI GATC 2 cut(s) 85, 229
BssT1I CCWWGG 2 cut(s) 144, 288
BstDEI CTNAG 2 cut(s) 56, 200
BstDSI CCRYGG 2 cut(s) 144, 288
BstH2I RGCGCY 1 cut(s) 192
BstHHI GCGC 1 cut(s) 191
BstKTI GATC 2 cut(s) 88, 232
BstMBI GATC 2 cut(s) 85, 229
BstMWI GCNNNNNNNGC 1 cut(s) 51
BstSLI GKGCMC 1 cut(s) 47
BstX2I RGATCY 2 cut(s) 85, 229
BstYI RGATCY 2 cut(s) 85, 229
BtgI CCRYGG 2 cut(s) 144, 288
BtsIMutI CAGTG 4 cut(s) 64, 77, 208, 221
CfoI GCGC 1 cut(s) 191
CviAII CATG 2 cut(s) 145, 289
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
DdeI CTNAG 2 cut(s) 56, 200
DpnI GATC 2 cut(s) 87, 231
DpnII GATC 2 cut(s) 85, 229
Eco130I CCWWGG 2 cut(s) 144, 288
Eco57I CTGAAG 1 cut(s) 110
EcoT14I CCWWGG 2 cut(s) 144, 288
ErhI CCWWGG 2 cut(s) 144, 288
FaeI CATG 2 cut(s) 148, 292
FaiI YATR 4 cut(s) 37, 117, 146, 290
FatI CATG 2 cut(s) 144, 288
FspBI CTAG 1 cut(s) 179
GlaI GCGC 1 cut(s) 190
HaeII RGCGCY 1 cut(s) 192
HhaI GCGC 1 cut(s) 191
Hin1II CATG 2 cut(s) 148, 292
Hin6I GCGC 1 cut(s) 189
HinP1I GCGC 1 cut(s) 189
Hpy188I TCNGA 4 cut(s) 72, 90, 216, 234
Hpy188III TCNNGA 1 cut(s) 179
HpyF10VI GCNNNNNNNGC 1 cut(s) 51
HpyF3I CTNAG 2 cut(s) 56, 200
Hsp92II CATG 2 cut(s) 148, 292
HspAI GCGC 1 cut(s) 189
Kzo9I GATC 2 cut(s) 85, 229
LpnPI CCDG 6 cut(s) 29, 65, 117, 173, 209, 261
MaeI CTAG 1 cut(s) 179
MalI GATC 2 cut(s) 87, 231
MboI GATC 2 cut(s) 85, 229
MboII GAAGA 1 cut(s) 103
MflI RGATCY 2 cut(s) 85, 229
MhlI GDGCHC 1 cut(s) 47
MluCI AATT 2 cut(s) 66, 210
MmeI TCCRAC 2 cut(s) 95, 239
MnlI CCTC 2 cut(s) 65, 266
MwoI GCNNNNNNNGC 1 cut(s) 51
NcoI CCATGG 2 cut(s) 144, 288
NdeII GATC 2 cut(s) 85, 229
NlaIII CATG 2 cut(s) 148, 292
PsuI RGATCY 2 cut(s) 85, 229
Sau3AI GATC 2 cut(s) 85, 229
SduI GDGCHC 1 cut(s) 47
SetI ASST 5 cut(s) 18, 99, 162, 243, 306
SmlI CTYRAG 1 cut(s) 184
SmoI CTYRAG 1 cut(s) 184
Sse9I AATT 2 cut(s) 66, 210
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 2 cut(s) 144, 288
TasI AATT 2 cut(s) 66, 210
TscAI CASTG 4 cut(s) 64, 84, 208, 228
TspRI CASTG 4 cut(s) 64, 84, 208, 228
XbaI TCTAGA 1 cut(s) 178
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.