Rmu_sc0003622.1_g000007

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003622.1
Physical Location & Seq
Reverse (-)
51004 .. 51396
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003622.1_g000007.1.cds

Sequence Viewer

Length: 393 bp
atggagataggaaatctgaaatcattggtaggtctagacttgagcgccaatcaactcactggttcaattcccacaacactgggtgatctgaccaaccttgccactctctatcttagttctaataatagtactggcactatttttatggaaataggaaacctgaaatcattggtaggtctaagcttgtatgccaatcaactcagtggttcaattccgacaacattaggtggtctgaccaaccttatcactctctatctctataaaaataatctttctggcactattcctatggagataggaaacctgaaatcattggtgggtctagacttgagtgccaatcactctcagtggttcaattcccacaacactgggggatctgaccaaccttactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

130

Amino Acids

13.72

Weight (kDa)

4.96

Isoelectric Point (pI)

9.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 382
AdeI CACNNNGTG 1 cut(s) 83
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 3 cut(s) 66, 210, 355
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
AlwI GGATC 1 cut(s) 382
AspLEI GCGC 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 95
BfaI CTAG 3 cut(s) 35, 323, 391
BfoI RGCGCY 1 cut(s) 48
BmcAI AGTACT 1 cut(s) 130
BmrI ACTGGG 2 cut(s) 89, 378
BmuI ACTGGG 2 cut(s) 89, 378
BpuEI CTTGAG 2 cut(s) 61, 349
Bse1I ACTGG 4 cut(s) 64, 84, 136, 373
BseMII CTCAG 2 cut(s) 214, 359
BseNI ACTGG 4 cut(s) 64, 84, 136, 373
Bsp143I GATC 2 cut(s) 85, 374
BspCNI CTCAG 2 cut(s) 213, 358
BspPI GGATC 1 cut(s) 382
BsrI ACTGG 4 cut(s) 64, 84, 136, 373
BssMI GATC 2 cut(s) 85, 374
BstDEI CTNAG 4 cut(s) 113, 179, 200, 345
BstH2I RGCGCY 1 cut(s) 48
BstHHI GCGC 1 cut(s) 47
BstKTI GATC 2 cut(s) 88, 377
BstMBI GATC 2 cut(s) 85, 374
BstX2I RGATCY 1 cut(s) 374
BstXI CCANNNNNNTGG 2 cut(s) 79, 368
BstYI RGATCY 1 cut(s) 374
BtsIMutI CAGTG 5 cut(s) 57, 77, 208, 353, 366
CfoI GCGC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 1 cut(s) 183
CviKI_1 RGCY 1 cut(s) 183
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 4 cut(s) 113, 179, 200, 345
DpnI GATC 2 cut(s) 87, 376
DpnII GATC 2 cut(s) 85, 374
DraIII CACNNNGTG 1 cut(s) 83
FaiI YATR 4 cut(s) 146, 189, 261, 290
FspBI CTAG 3 cut(s) 35, 323, 391
GlaI GCGC 1 cut(s) 46
HaeII RGCGCY 1 cut(s) 48
HhaI GCGC 1 cut(s) 47
Hin6I GCGC 1 cut(s) 45
HinP1I GCGC 1 cut(s) 45
HindIII AAGCTT 1 cut(s) 181
HphI GGTGA 1 cut(s) 95
Hpy188I TCNGA 5 cut(s) 18, 90, 216, 234, 379
Hpy188III TCNNGA 2 cut(s) 35, 323
HpyF3I CTNAG 4 cut(s) 113, 179, 200, 345
HspAI GCGC 1 cut(s) 45
Kzo9I GATC 2 cut(s) 85, 374
LpnPI CCDG 7 cut(s) 45, 65, 117, 173, 261, 317, 354
MaeI CTAG 3 cut(s) 35, 323, 391
MalI GATC 2 cut(s) 87, 376
MboI GATC 2 cut(s) 85, 374
MflI RGATCY 1 cut(s) 374
MluCI AATT 3 cut(s) 66, 210, 355
MmeI TCCRAC 1 cut(s) 239
NdeII GATC 2 cut(s) 85, 374
PsuI RGATCY 1 cut(s) 374
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
Sau3AI GATC 2 cut(s) 85, 374
ScaI AGTACT 1 cut(s) 130
SetI ASST 9 cut(s) 34, 99, 162, 178, 185, 229, 243, 306, 388
SmlI CTYRAG 2 cut(s) 40, 328
SmoI CTYRAG 2 cut(s) 40, 328
Sse9I AATT 3 cut(s) 66, 210, 355
SspMI CTAG 3 cut(s) 35, 323, 391
TasI AATT 3 cut(s) 66, 210, 355
TatI WGTACW 1 cut(s) 128
TscAI CASTG 5 cut(s) 64, 84, 208, 353, 373
TspRI CASTG 5 cut(s) 64, 84, 208, 353, 373
XbaI TCTAGA 2 cut(s) 34, 322
XspI CTAG 3 cut(s) 35, 323, 391
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.