Rmu_sc0000987.1_g000018

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000987.1
Physical Location & Seq
Forward (+)
72769 .. 73422
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000987.1_g000018.1.cds

Sequence Viewer

Length: 273 bp
atggagatagggaacttgaaatctttggtggatctacaattgaacatgaatcaacttagtggttcaattccgacaacattagccataggaatagctgggaacaaacttactggttctataccagctatgattggaaaggcaacccaaattcatgagctggatctttcttcaaatgatttagtcgagacaattccaaaggagtttgggggattaacttcaatggtgaagctgaggttggatgacaacaagctttcaggtcgtgtcccttcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.53

Weight (kDa)

5.65

Isoelectric Point (pI)

21.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 39, 168
AcsI RAATTY 1 cut(s) 147
AgsI TTSAA 5 cut(s) 19, 43, 66, 171, 219
AjuI GAANNNNNNNTTGG 2 cut(s) 218, 250
AluBI AGCT 5 cut(s) 95, 125, 157, 229, 250
AluI AGCT 5 cut(s) 95, 125, 157, 229, 250
Alw26I GTCTC 1 cut(s) 179
AlwI GGATC 2 cut(s) 39, 168
ApoI RAATTY 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 235
BbvCI CCTCAGC 1 cut(s) 230
BcoDI GTCTC 1 cut(s) 179
Bpu10I CCTNAGC 1 cut(s) 230
Bse1I ACTGG 1 cut(s) 115
BseGI GGATG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 115
BseYI CCCAGC 1 cut(s) 95
BslFI GGGAC 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 248
Bsp143I GATC 2 cut(s) 31, 160
BspCNI CTCAG 1 cut(s) 222
BspHI TCATGA 1 cut(s) 151
BspPI GGATC 2 cut(s) 39, 168
BsrI ACTGG 1 cut(s) 115
BssMI GATC 2 cut(s) 31, 160
BstDEI CTNAG 2 cut(s) 56, 230
BstF5I GGATG 1 cut(s) 244
BstKTI GATC 2 cut(s) 34, 163
BstMAI GTCTC 1 cut(s) 179
BstMBI GATC 2 cut(s) 31, 160
BstX2I RGATCY 2 cut(s) 31, 160
BstYI RGATCY 2 cut(s) 31, 160
BtsCI GGATG 1 cut(s) 244
CciI TCATGA 1 cut(s) 151
CviAII CATG 2 cut(s) 46, 152
CviJI RGCY 6 cut(s) 83, 95, 125, 157, 229, 250
CviKI_1 RGCY 6 cut(s) 83, 95, 125, 157, 229, 250
DdeI CTNAG 2 cut(s) 56, 230
DpnI GATC 2 cut(s) 33, 162
DpnII GATC 2 cut(s) 31, 160
FaeI CATG 2 cut(s) 49, 155
FaiI YATR 6 cut(s) 47, 86, 119, 128, 153, 271
FaqI GGGAC 1 cut(s) 248
FatI CATG 2 cut(s) 45, 151
FokI GGATG 1 cut(s) 251
GsaI CCCAGC 1 cut(s) 99
Hin1II CATG 2 cut(s) 49, 155
HindIII AAGCTT 1 cut(s) 248
HinfI GANTC 1 cut(s) 49
HphI GGTGA 1 cut(s) 235
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 2 cut(s) 152, 184
HpyF3I CTNAG 2 cut(s) 56, 230
Hsp92II CATG 2 cut(s) 49, 155
Kzo9I GATC 2 cut(s) 31, 160
LpnPI CCDG 5 cut(s) 81, 96, 135, 143, 240
MalI GATC 2 cut(s) 33, 162
MboI GATC 2 cut(s) 31, 160
MboII GAAGA 1 cut(s) 159
MfeI CAATTG 1 cut(s) 38
MflI RGATCY 2 cut(s) 31, 160
MluCI AATT 4 cut(s) 38, 66, 147, 189
MmeI TCCRAC 2 cut(s) 95, 216
MnlI CCTC 1 cut(s) 225
MseI TTAA 1 cut(s) 212
MunI CAATTG 1 cut(s) 38
NdeII GATC 2 cut(s) 31, 160
NlaIII CATG 2 cut(s) 49, 155
PagI TCATGA 1 cut(s) 151
PfeI GAWTC 1 cut(s) 49
PspFI CCCAGC 1 cut(s) 95
PsuI RGATCY 2 cut(s) 31, 160
SaqAI TTAA 1 cut(s) 212
Sau3AI GATC 2 cut(s) 31, 160
SetI ASST 7 cut(s) 97, 127, 159, 231, 236, 252, 259
Sse9I AATT 4 cut(s) 38, 66, 147, 189
TaqI TCGA 1 cut(s) 183
TasI AATT 4 cut(s) 38, 66, 147, 189
TfiI GAWTC 1 cut(s) 49
Tru1I TTAA 1 cut(s) 212
Tru9I TTAA 1 cut(s) 212
TspDTI ATGAA 3 cut(s) 62, 140, 258
XapI RAATTY 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.