pycom11g26550

Dephospho-CoA kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
29085163 .. 29085387
225 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGTCACTCGATTTGAAAAGGACCAAGGCAGACATAGTGGTTGACAACACTGGATCGCTAGACGATTTAAGAGAACAGTTTCGCAATGTCTTGCTTGAAGTCACAAAGCCCTTGACATGGACCGAATTCGGGCTTTCTAGACAAGGTGCCTCGTCCGTTCTTGTCTCCATCATCGTAGGTGTTCTTATATTCAAGAAAGTCTTGTATAAGTCAGAGTTTATGTAG

Protein Analysis

75

Amino Acids

8.36

Weight (kDa)

8.06

Isoelectric Point (pI)

18.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016964)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 146
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 125
AfiI CCNNNNNNNGG 2 cut(s) 117, 129
AgsI TTSAA 3 cut(s) 16, 98, 193
Alw26I GTCTC 1 cut(s) 169
AlwI GGATC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 125
Asp700I GAANNNNTTC 1 cut(s) 78
AspS9I GGNCC 2 cut(s) 21, 120
AvaII GGWCC 2 cut(s) 21, 120
BanI GGYRCC 1 cut(s) 146
BccI CCATC 1 cut(s) 176
BcoDI GTCTC 1 cut(s) 169
BfaI CTAG 2 cut(s) 59, 138
Bme18I GGWCC 2 cut(s) 21, 120
BmgT120I GGNCC 2 cut(s) 21, 120
BmiI GGNNCC 1 cut(s) 148
BsaJI CCNNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 2 cut(s) 117, 129
Bse1I ACTGG 1 cut(s) 55
Bse3DI GCAATG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 117, 129
BseMI GCAATG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 55
BshNI GGYRCC 1 cut(s) 146
BslI CCNNNNNNNGG 2 cut(s) 117, 129
BsmAI GTCTC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 53
BspLI GGNNCC 1 cut(s) 148
BspPI GGATC 1 cut(s) 61
BspT107I GGYRCC 1 cut(s) 146
BsrDI GCAATG 1 cut(s) 91
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 1 cut(s) 53
BssT1I CCWWGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 78
BstKTI GATC 1 cut(s) 56
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 48
Cfr13I GGNCC 2 cut(s) 21, 120
CviAII CATG 1 cut(s) 117
CviJI RGCY 2 cut(s) 109, 133
CviKI_1 RGCY 2 cut(s) 109, 133
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eco130I CCWWGG 1 cut(s) 24
Eco47I GGWCC 2 cut(s) 21, 120
EcoRI GAATTC 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 24
ErhI CCWWGG 1 cut(s) 24
FaeI CATG 1 cut(s) 120
FaiI YATR 5 cut(s) 35, 118, 188, 207, 221
FalI AAGNNNNNCTT 2 cut(s) 185, 217
FatI CATG 1 cut(s) 116
FspBI CTAG 2 cut(s) 59, 138
Hin1II CATG 1 cut(s) 120
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 2 cut(s) 138, 193
Hpy8I GTNNAC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 78
Hsp92II CATG 1 cut(s) 120
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 36
MaeI CTAG 2 cut(s) 59, 138
MaeIII GTNAC 2 cut(s) 3, 100
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MluCI AATT 1 cut(s) 125
MnlI CCTC 1 cut(s) 160
MroXI GAANNNNTTC 1 cut(s) 78
MseI TTAA 1 cut(s) 68
NdeII GATC 1 cut(s) 53
NlaIII CATG 1 cut(s) 120
NlaIV GGNNCC 1 cut(s) 148
NmuCI GTSAC 2 cut(s) 3, 100
PdmI GAANNNNTTC 1 cut(s) 78
PspN4I GGNNCC 1 cut(s) 148
PspPI GGNCC 2 cut(s) 21, 120
SaqAI TTAA 1 cut(s) 68
Sau3AI GATC 1 cut(s) 53
Sau96I GGNCC 2 cut(s) 21, 120
SetI ASST 2 cut(s) 148, 181
SinI GGWCC 2 cut(s) 21, 120
Sse9I AATT 1 cut(s) 125
SspMI CTAG 2 cut(s) 59, 138
StyI CCWWGG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 78
TaqI TCGA 1 cut(s) 9
TaqII GACCGA 1 cut(s) 137
TasI AATT 1 cut(s) 125
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TscAI CASTG 1 cut(s) 55
TseFI GTSAC 2 cut(s) 3, 100
Tsp45I GTSAC 2 cut(s) 3, 100
TspGWI ACGGA 1 cut(s) 145
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 2 cut(s) 21, 120
XapI RAATTY 1 cut(s) 125
XbaI TCTAGA 1 cut(s) 137
XmnI GAANNNNTTC 1 cut(s) 78
XspI CTAG 2 cut(s) 59, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.