Rh1DG139300

Dephospho-CoA kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
29443910 .. 29444179
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG139300.1

Sequence Viewer

Length: 270 bp
ATGGCAGACATGGTGATTGATAACACTGGATCACAAGAGGATTTCAAAGACAAGTTTAGAAGCGTGGTATTTGAGGTCACAAAGCCCTTGTCATGGACTGAACTTTGGCTTTCTCACCAAGGTGCTTCATCTGCTCTTGTCTCCATTATCGTAGGTGTTCTTACGTTCAGAAAAGTTTATAATAGTGACAGTAAATTACAGCAACCTTGGAGTTGTAAACAAGTCGACTCAAAATATGACTGCCTTAAATTCAGATTTTACTTGGATTGA

Protein Analysis

89

Amino Acids

10.3

Weight (kDa)

6.55

Isoelectric Point (pI)

40.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016964)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 180
AccI GTMKAC 1 cut(s) 225
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 1 cut(s) 46
AleI CACNNNNGTG 1 cut(s) 120
Alw26I GTCTC 1 cut(s) 145
AlwI GGATC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 248
ArsI GACNNNNNNTTYG 2 cut(s) 74, 106
AsuHPI GGTGA 2 cut(s) 25, 107
BcoDI GTCTC 1 cut(s) 145
BsaJI CCNNGG 2 cut(s) 118, 206
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 31
BseDI CCNNGG 2 cut(s) 118, 206
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 29
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 118, 206
BssMI GATC 1 cut(s) 29
BssT1I CCWWGG 2 cut(s) 118, 206
Bst4CI ACNGT 1 cut(s) 191
BstKTI GATC 1 cut(s) 32
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 1 cut(s) 29
BstMWI GCNNNNNNNGC 1 cut(s) 131
BtsIMutI CAGTG 1 cut(s) 24
CviAII CATG 2 cut(s) 10, 93
CviJI RGCY 2 cut(s) 85, 109
CviKI_1 RGCY 2 cut(s) 85, 109
DpnI GATC 1 cut(s) 31
DpnII GATC 1 cut(s) 29
Eco130I CCWWGG 2 cut(s) 118, 206
EcoT14I CCWWGG 2 cut(s) 118, 206
ErhI CCWWGG 2 cut(s) 118, 206
FaeI CATG 2 cut(s) 13, 96
FaiI YATR 4 cut(s) 11, 94, 180, 237
FatI CATG 2 cut(s) 9, 92
FblI GTMKAC 1 cut(s) 225
Hin1II CATG 2 cut(s) 13, 96
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 1 cut(s) 227
HphI GGTGA 2 cut(s) 25, 107
Hpy166II GTNNAC 2 cut(s) 218, 226
Hpy188I TCNGA 2 cut(s) 170, 254
Hpy8I GTNNAC 2 cut(s) 218, 226
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4IV ACGT 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpySE526I ACGT 1 cut(s) 164
Hsp92II CATG 2 cut(s) 13, 96
Kzo9I GATC 1 cut(s) 29
LpnPI CCDG 1 cut(s) 12
MaeII ACGT 1 cut(s) 164
MaeIII GTNAC 2 cut(s) 76, 185
MalI GATC 1 cut(s) 31
MboI GATC 1 cut(s) 29
MluCI AATT 2 cut(s) 194, 248
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 2 cut(s) 31, 67
MseI TTAA 1 cut(s) 246
MslI CAYNNNNRTG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 1 cut(s) 29
NlaIII CATG 2 cut(s) 13, 96
NmuCI GTSAC 2 cut(s) 76, 185
OliI CACNNNNGTG 1 cut(s) 120
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
PsiI TTATAA 1 cut(s) 180
RseI CAYNNNNRTG 1 cut(s) 120
SalI GTCGAC 1 cut(s) 224
SaqAI TTAA 1 cut(s) 246
Sau3AI GATC 1 cut(s) 29
SchI GAGTC 1 cut(s) 221
SetI ASST 5 cut(s) 78, 124, 157, 167, 208
SmiMI CAYNNNNRTG 1 cut(s) 120
Sse9I AATT 2 cut(s) 194, 248
StyI CCWWGG 2 cut(s) 118, 206
TaaI ACNGT 1 cut(s) 191
TaiI ACGT 1 cut(s) 167
TaqI TCGA 1 cut(s) 225
TasI AATT 2 cut(s) 194, 248
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TscAI CASTG 1 cut(s) 31
TseFI GTSAC 2 cut(s) 76, 185
Tsp45I GTSAC 2 cut(s) 76, 185
TspDTI ATGAA 1 cut(s) 117
TspRI CASTG 1 cut(s) 31
XapI RAATTY 1 cut(s) 248
XmiI GTMKAC 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.