Rroxscaffold_5G00362100

Dephospho-CoA kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
42968340 .. 42968627
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00362100.1

Sequence Viewer

Length: 288 bp
ATGTGGTGTTTTCCTATTTCATATGAGATGTCACTCGATTTAAAGAGGGCTAAGGCAAACATAGTGATTGATAACATTGGATCACAAGAGAATTTAAAGGAGAAGTTTAAGAGTGTGCTATTTGAGGTCACAAAGACCTTGACATGGATTGAATTTTGGCTTTCTCAACAAGGTGCTCCATGTGCTCTTGTCTCCATCATCGTAGGTGTTCTTATGTTTAGAAAAGTTTATAATAGTGATAGTAAATTATACAACTTCAGAGTTGTACTTATTGAGATATTGATCTAA

Protein Analysis

95

Amino Acids

11.04

Weight (kDa)

8.62

Isoelectric Point (pI)

40.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016964)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 231
AclWI GGATC 1 cut(s) 88
AcsI RAATTY 2 cut(s) 91, 152
AcuI CTGAAG 1 cut(s) 241
AfaI GTAC 1 cut(s) 267
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 152
Alw21I GWGCWC 2 cut(s) 178, 187
Alw26I GTCTC 1 cut(s) 196
AlwI GGATC 1 cut(s) 88
ApoI RAATTY 2 cut(s) 91, 152
Bbv12I GWGCWC 2 cut(s) 178, 187
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 196
Bpu10I CCTNAGC 1 cut(s) 51
BsaBI GATNNNNATC 1 cut(s) 281
Bsc4I CCNNNNNNNGG 1 cut(s) 144
Bse8I GATNNNNATC 1 cut(s) 281
BseJI GATNNNNATC 1 cut(s) 281
BseLI CCNNNNNNNGG 1 cut(s) 144
BsiHKAI GWGCWC 2 cut(s) 178, 187
BslI CCNNNNNNNGG 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 196
Bsp1286I GDGCHC 2 cut(s) 178, 187
Bsp143I GATC 2 cut(s) 80, 282
BspPI GGATC 1 cut(s) 88
BssMI GATC 2 cut(s) 80, 282
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 2 cut(s) 83, 285
BstMAI GTCTC 1 cut(s) 196
BstMBI GATC 2 cut(s) 80, 282
BstMWI GCNNNNNNNGC 1 cut(s) 182
Csp6I GTAC 1 cut(s) 266
CviAII CATG 2 cut(s) 144, 180
CviJI RGCY 2 cut(s) 50, 160
CviKI_1 RGCY 2 cut(s) 50, 160
CviQI GTAC 1 cut(s) 266
DdeI CTNAG 1 cut(s) 51
DpnI GATC 2 cut(s) 82, 284
DpnII GATC 2 cut(s) 80, 282
DraI TTTAAA 2 cut(s) 42, 96
Eco57I CTGAAG 1 cut(s) 241
FaeI CATG 2 cut(s) 147, 183
FaiI YATR 8 cut(s) 22, 24, 62, 145, 181, 215, 231, 250
FatI CATG 2 cut(s) 143, 179
FauNDI CATATG 1 cut(s) 22
Hin1II CATG 2 cut(s) 147, 183
Hpy188I TCNGA 1 cut(s) 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 147, 183
Kzo9I GATC 2 cut(s) 80, 282
LmnI GCTCC 1 cut(s) 181
MaeIII GTNAC 2 cut(s) 30, 127
MalI GATC 2 cut(s) 82, 284
MboI GATC 2 cut(s) 80, 282
MhlI GDGCHC 2 cut(s) 178, 187
MluCI AATT 3 cut(s) 91, 152, 245
MnlI CCTC 2 cut(s) 39, 118
MseI TTAA 3 cut(s) 41, 95, 108
MwoI GCNNNNNNNGC 1 cut(s) 182
NdeI CATATG 1 cut(s) 22
NdeII GATC 2 cut(s) 80, 282
NlaIII CATG 2 cut(s) 147, 183
NmuCI GTSAC 2 cut(s) 30, 127
PsiI TTATAA 1 cut(s) 231
RsaI GTAC 1 cut(s) 267
RsaNI GTAC 1 cut(s) 266
SaqAI TTAA 3 cut(s) 41, 95, 108
Sau3AI GATC 2 cut(s) 80, 282
SduI GDGCHC 2 cut(s) 178, 187
SetI ASST 4 cut(s) 129, 140, 175, 208
SgeI CNNG 7 cut(s) 47, 98, 151, 156, 182, 192, 200
Sse9I AATT 3 cut(s) 91, 152, 245
TaqI TCGA 1 cut(s) 36
TasI AATT 3 cut(s) 91, 152, 245
TatI WGTACW 1 cut(s) 265
Tru1I TTAA 3 cut(s) 41, 95, 108
Tru9I TTAA 3 cut(s) 41, 95, 108
TseFI GTSAC 2 cut(s) 30, 127
Tsp45I GTSAC 2 cut(s) 30, 127
TspDTI ATGAA 1 cut(s) 9
XapI RAATTY 2 cut(s) 91, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.