Rh4CG230100

Dephospho-CoA kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
46883882 .. 46886155
2274 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG230100.1

Sequence Viewer

Length: 222 bp
ATGTTGAGGGACAGAACAAGTGGGGATGATGCTCGAAATCAGATAAATGCTCAGATGTCACTCAATTTAAAGAGGGCTAAGGCAAACATAGTGATTGATAACACTGGATCACAAGAGAAGTTTAAGAGTGTGCTATTTGAGGTCACAACGCCCTTGACATCGATTGAATTTTGGCTTTCTCGACAAGGTGCTCCATCTGCTCTTGTCTCCATCATCAGATAG

Protein Analysis

73

Amino Acids

8.15

Weight (kDa)

9.98

Isoelectric Point (pI)

43.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016964)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 115
AcsI RAATTY 1 cut(s) 167
AgsI TTSAA 1 cut(s) 167
Alw21I GWGCWC 1 cut(s) 193
Alw26I GTCTC 1 cut(s) 211
AlwI GGATC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 193
BccI CCATC 2 cut(s) 202, 218
BcoDI GTCTC 1 cut(s) 211
BmsI GCATC 1 cut(s) 19
Bpu10I CCTNAGC 1 cut(s) 78
Bsa29I ATCGAT 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 109
BseCI ATCGAT 1 cut(s) 161
BseGI GGATG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 109
BshVI ATCGAT 1 cut(s) 161
BsiHKAI GWGCWC 1 cut(s) 193
BslFI GGGAC 1 cut(s) 23
BsmAI GTCTC 1 cut(s) 211
BsmFI GGGAC 1 cut(s) 23
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 64
BspDI ATCGAT 1 cut(s) 161
BspPI GGATC 1 cut(s) 115
BsrI ACTGG 1 cut(s) 109
BssMI GATC 1 cut(s) 107
BstDEI CTNAG 2 cut(s) 51, 78
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 1 cut(s) 110
BstMAI GTCTC 1 cut(s) 211
BstMBI GATC 1 cut(s) 107
BstMWI GCNNNNNNNGC 1 cut(s) 197
Bsu15I ATCGAT 1 cut(s) 161
BsuTUI ATCGAT 1 cut(s) 161
BtsCI GGATG 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 102
ClaI ATCGAT 1 cut(s) 161
CviJI RGCY 2 cut(s) 77, 175
CviKI_1 RGCY 2 cut(s) 77, 175
DdeI CTNAG 2 cut(s) 51, 78
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
DraI TTTAAA 1 cut(s) 69
FaiI YATR 1 cut(s) 89
FaqI GGGAC 1 cut(s) 23
FokI GGATG 1 cut(s) 38
Hpy188I TCNGA 3 cut(s) 42, 54, 218
Hpy188III TCNNGA 1 cut(s) 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 2 cut(s) 51, 78
Kzo9I GATC 1 cut(s) 107
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 1 cut(s) 90
LweI GCATC 1 cut(s) 19
MaeIII GTNAC 2 cut(s) 57, 142
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 2 cut(s) 64, 167
MnlI CCTC 2 cut(s) 66, 133
MseI TTAA 2 cut(s) 68, 123
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 1 cut(s) 107
NmuCI GTSAC 2 cut(s) 57, 142
SaqAI TTAA 2 cut(s) 68, 123
Sau3AI GATC 1 cut(s) 107
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 144, 190
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 8 cut(s) 30, 45, 117, 125, 166, 192, 197, 215
Sse9I AATT 2 cut(s) 64, 167
TaqI TCGA 3 cut(s) 34, 161, 181
TasI AATT 2 cut(s) 64, 167
Tru1I TTAA 2 cut(s) 68, 123
Tru9I TTAA 2 cut(s) 68, 123
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 2 cut(s) 57, 142
Tsp45I GTSAC 2 cut(s) 57, 142
TspRI CASTG 1 cut(s) 109
XapI RAATTY 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.