pycom12486g00040

Protein BRANCHLESS TRICHOME

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012486
Physical Location & Seq
Reverse (-)
58231 .. 58488
258 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGGAGGAGATGTTCATAATGATGAGCACCAGTAGTACTACTACTCCTAGCCCTGAAAATACCAGAAATATTGAAATCACCACCTCCACTTTCCCAACCTGGAAACTTTACAAAAACCATTTTTATAATTATCGAAAACTCCATCAAATCCACCCCTCCAACAACAAACGGATCTATAGTTTTCCGATTATAATAAATAGTTACATACTATTTGTAGTAAGTAGATGCTATTTGTACCAGAGAATCCAATGTATCTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

10.29

Weight (kDa)

9.47

Isoelectric Point (pI)

59.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 126, 191
AclWI GGATC 1 cut(s) 179
AfaI GTAC 2 cut(s) 37, 236
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 98
AloI GAACNNNNNNTCC 1 cut(s) 28
Alw21I GWGCWC 1 cut(s) 29
AlwI GGATC 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 29
BccI CCATC 1 cut(s) 150
BciT130I CCWGG 1 cut(s) 100
BfaI CTAG 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 175
BmcAI AGTACT 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BmsI GCATC 1 cut(s) 215
BsaXI ACNNNNNCTCC 3 cut(s) 26, 28, 58
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 20
BsiHKAI GWGCWC 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 171
BspPI GGATC 1 cut(s) 179
BsrI ACTGG 1 cut(s) 30
BssMI GATC 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 100
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
BstSFI CTRYAG 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 171
BstYI RGATCY 1 cut(s) 171
Csp6I GTAC 2 cut(s) 36, 235
CviJI RGCY 1 cut(s) 51
CviKI_1 RGCY 1 cut(s) 51
CviQI GTAC 2 cut(s) 36, 235
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
EcoRII CCWGG 1 cut(s) 98
FaiI YATR 5 cut(s) 17, 126, 177, 191, 206
FspBI CTAG 1 cut(s) 48
HinfI GANTC 1 cut(s) 243
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 186
Kzo9I GATC 1 cut(s) 171
LpnPI CCDG 6 cut(s) 43, 66, 76, 85, 112, 251
LweI GCATC 1 cut(s) 215
MaeI CTAG 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MflI RGATCY 1 cut(s) 171
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 2 cut(s) 94, 166
MslI CAYNNNNRTG 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
NdeII GATC 1 cut(s) 171
PfeI GAWTC 1 cut(s) 243
PsiI TTATAA 2 cut(s) 126, 191
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
PsuI RGATCY 1 cut(s) 171
RsaI GTAC 2 cut(s) 37, 236
RsaNI GTAC 2 cut(s) 36, 235
RseI CAYNNNNRTG 1 cut(s) 20
Sau3AI GATC 1 cut(s) 171
ScaI AGTACT 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 100
SduI GDGCHC 1 cut(s) 29
SetI ASST 2 cut(s) 86, 101
SfaNI GCATC 1 cut(s) 215
SfcI CTRYAG 1 cut(s) 175
SgeI CNNG 7 cut(s) 42, 60, 65, 75, 111, 112, 250
SmiMI CAYNNNNRTG 1 cut(s) 20
Sse9I AATT 1 cut(s) 127
SspI AATATT 1 cut(s) 70
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 98
TaqI TCGA 1 cut(s) 133
TasI AATT 1 cut(s) 127
TatI WGTACW 1 cut(s) 35
TfiI GAWTC 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 4
TspGWI ACGGA 1 cut(s) 184
XspI CTAG 1 cut(s) 48
ZrmI AGTACT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.