pycom12646g00050

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012646
Physical Location & Seq
Forward (+)
132361 .. 132988
628 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12646g00050.1

Sequence Viewer

Length: 414 bp
ATGAAAAAAATTCCCGTCATCCCGGTACCCGCCCAACTCGTCCAACCCATCGCCCTCTCCAACCCATACCACCCCCTTTCTTCAACCCCTAAAATCATCATCCACTTCCCAAGCCCGTTCCTCACCAATCTCTCCAACTTTTTCCAACCCACATTCTCACAAAATATTGGAAGAATAAGTCGTCCTACAGCCGTCAAGCCGTCCTACAGCTGTCCTACCTTGTCCTACCTACACACTAGCCGTCCTACAGCCGTCAAACCGTCCTACAGCCGTCCTACCTTGTCCTACCTACACACTAGGACAGCTACCTTGTCCCCTACAGCCGTCCTACCTTGTCCTACCTACACACTAGGACGGCTACCTTGTCCTACCTACACACTTGTATCATGTATATATATCCTTGTAATCTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.14

Weight (kDa)

9.98

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 25
AccB1I GGYRCC 1 cut(s) 25
AciI CCGC 1 cut(s) 30
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 84
AluBI AGCT 2 cut(s) 210, 305
AluI AGCT 2 cut(s) 210, 305
ApoI RAATTY 1 cut(s) 9
Asp718I GGTACC 1 cut(s) 25
AsuC2I CCSGG 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 115
BaeI ACNNNNGTAYC 2 cut(s) 366, 399
BanI GGYRCC 1 cut(s) 25
BccI CCATC 1 cut(s) 56
BceAI ACGGC 7 cut(s) 176, 184, 225, 236, 255, 308, 371
BcnI CCSGG 1 cut(s) 23
BfaI CTAG 3 cut(s) 237, 297, 350
BfmI CTRYAG 5 cut(s) 186, 205, 246, 265, 318
Bme1390I CCNGG 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 27
BmrFI CCNGG 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 23
BseGI GGATG 2 cut(s) 18, 99
BshNI GGYRCC 1 cut(s) 25
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 298
BsmFI GGGAC 1 cut(s) 298
BspACI CCGC 1 cut(s) 30
BspLI GGNNCC 1 cut(s) 27
BspT107I GGYRCC 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 261
BstF5I GGATG 2 cut(s) 18, 99
BstSCI CCNGG 1 cut(s) 21
BstSFI CTRYAG 5 cut(s) 186, 205, 246, 265, 318
BtgZI GCGATG 1 cut(s) 34
BtsCI GGATG 2 cut(s) 18, 99
Csp6I GTAC 1 cut(s) 26
CviAII CATG 1 cut(s) 387
CviQI GTAC 1 cut(s) 26
FaeI CATG 1 cut(s) 390
FaiI YATR 5 cut(s) 67, 388, 392, 394, 396
FaqI GGGAC 1 cut(s) 298
FatI CATG 1 cut(s) 386
FauI CCCGC 1 cut(s) 37
FokI GGATG 2 cut(s) 5, 86
FspBI CTAG 3 cut(s) 237, 297, 350
HapII CCGG 1 cut(s) 23
Hin1II CATG 1 cut(s) 390
HpaII CCGG 1 cut(s) 23
HphI GGTGA 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 261
Hsp92II CATG 1 cut(s) 390
KpnI GGTACC 1 cut(s) 29
LpnPI CCDG 1 cut(s) 36
MaeI CTAG 3 cut(s) 237, 297, 350
MboII GAAGA 2 cut(s) 72, 183
MluCI AATT 1 cut(s) 9
MmeI TCCRAC 4 cut(s) 67, 84, 159, 169
MnlI CCTC 2 cut(s) 65, 131
MspA1I CMGCKG 1 cut(s) 210
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 23
NciI CCSGG 1 cut(s) 23
NlaIII CATG 1 cut(s) 390
NlaIV GGNNCC 1 cut(s) 27
PspN4I GGNNCC 1 cut(s) 27
PvuII CAGCTG 1 cut(s) 210
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 23
SfcI CTRYAG 5 cut(s) 186, 205, 246, 265, 318
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 30
SspI AATATT 1 cut(s) 166
SspMI CTAG 3 cut(s) 237, 297, 350
StyD4I CCNGG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 261
TasI AATT 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 9
XspI CTAG 3 cut(s) 237, 297, 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.