Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr12

Orthogroup ID

OG0007912

Physical Location & Seq

Genomic Coordinates Reverse (-)

2019409 .. 2020311

Gene Structure 903 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12g02320.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 903 bp

ATGGAGCACCTTCCCGTTGAAGTCATAGGTAACATTCTATCCCGGCTAAAAGCTGCCCGAGATGTTGTGATTGCATCTGCGACGTGCAAGAAATGGAGAGAGGCTTGGCGGAATCACCTCCACACTCTTTCTTTTAATTCCAATGATTGGTCCGTCTATCATGATCTGACAACAAGTAGATTGGAAATTCTTATAACTCAAACAATATTCCAAACCACAGCATTGCAGTGTTTGTCAATTTTTATGGATGATGTTGATGAATTTTCAGCCGCCCCAGTGATTGCTTGGCTCATGTATACCCGGGACACCTTGCGGCAACTACATTATAATGTGAGGACTACTCCGAATGTGAATATCATTGAGAAATGCGGTCGGCAGAAGCTTGAAGTCTTGGCATTGGCTCATAATTCTGTAACAGGTGTTGAACCCAGTTATCAGAAATTTCCATGCTTGAAGTCACTTTCGCTAAGTTATGTCAGTATCTCAGCATTGGATTTGAGCCTTTTGCTTACTGCATGTCCAAAACTTCAGAATTTGGCTCTTATTAATCCTGATATTGCCATGTCAGATGCACAGGCAACTATGGAACTTAATAGTCCTTCACTGAAAAATATCTACGTGGAAGCTGTCAGTTTGGATAAGTTCATACTAGAGGCCGATAGCATTGAGAATCTGCACCTGAAAGATTGTACCCTTGAGGTTTTTGAGCTTATTGGTAAGGGGTCACTGAGTGTTTTGAAGATCGATGATGTCAGCGTCCTCCATCTCGATATTGGGGATAACACAGAGAATCTTCAGATTGTGGATGTTAGCAGCTTCACGATCATGTGGCCAAAGTTCTATAACATCGATCTCAAAATCATCAAATTTAAAGAGGCTTCGGCTCTGGGGTGTTGTATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like

Protein Analysis

301

Amino Acids

33.69

Weight (kDa)

5.37

Isoelectric Point (pI)

37.54

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
F-box-like	PF12937	2 - 36	8.3e-08	F-box-like
LRR_At5g56370	PF24758	126 - 229	9.2e-12	FBD-associated F-box protein At5g56370, LRR repeats

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007912)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67190 AT1G67190
fragaria_vesca	FvH4_6g18580
malus_domestica	MD14G1022200.v1.1
prunus_persica	Prupe.6G129400_v2.0.a1 Prupe.7G111200_v2.0.a1 Prupe.7G111200_v2.0.a1 Prupe.7G111200_v2.0.a1 Prupe.7G111200_v2.0.a1 Prupe.7G111200_v2.0.a1 Prupe.7G111200_v2.0.a1
pyrus_communis	pycom12g02320 pycom14g02120
rosa_chinensis	RchiOBHm_Chr3g0473131
rosa_laevigata	RLG00000024025
rosa_multiflora	Rmu_sc0016115.1_g000003
rosa_roxburghii	Rroxscaffold_6G00408290
rosa_rugosa	Rorug03G0131900
rosa_samantha	Rh3AG183300 Rh3BG209700 Rh3CG206800 Rh3DG206700
rosa_wichuraiana	Rw0G008090 Rw0G014720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	194, 327
AccB7I	CCANNNNNTGG	1 cut(s)	147
AccI	GTMKAC	1 cut(s)	296
AciI	CCGC	4 cut(s)	109, 270, 313, 369
AcoI	YGGCCR	1 cut(s)	830
AcsI	RAATTY	5 cut(s)	186, 260, 440, 532, 866
AcuI	CTGAAG	2 cut(s)	512, 779
AdeI	CACNNNGTG	1 cut(s)	731
AfaI	GTAC	1 cut(s)	691
AfiI	CCNNNNNNNGG	1 cut(s)	147
AgsI	TTSAA	5 cut(s)	20, 386, 425, 454, 739
AjiI	CACGTC	1 cut(s)	84
AluBI	AGCT	5 cut(s)	53, 382, 626, 709, 816
AluI	AGCT	5 cut(s)	53, 382, 626, 709, 816
Alw21I	GWGCWC	1 cut(s)	9
Ama87I	CYCGRG	2 cut(s)	57, 300
AoxI	GGCC	2 cut(s)	654, 830
ApeKI	GCWGC	2 cut(s)	53, 813
ApoI	RAATTY	5 cut(s)	186, 260, 440, 532, 866
AseI	ATTAAT	1 cut(s)	546
AspS9I	GGNCC	1 cut(s)	150
AsuC2I	CCSGG	3 cut(s)	43, 301, 302
AsuHPI	GGTGA	1 cut(s)	107
AvaI	CYCGRG	2 cut(s)	57, 300
AvaII	GGWCC	1 cut(s)	150
BalI	TGGCCA	1 cut(s)	832
Bbv12I	GWGCWC	1 cut(s)	9
BbvI	GCAGC	2 cut(s)	40, 825
BccI	CCATC	1 cut(s)	771
BcnI	CCSGG	3 cut(s)	43, 301, 302
BfaI	CTAG	1 cut(s)	650
BisI	GCNGC	4 cut(s)	54, 270, 314, 814
BlsI	GCNGC	4 cut(s)	55, 271, 315, 815
Bme1390I	CCNGG	3 cut(s)	43, 301, 302
Bme18I	GGWCC	1 cut(s)	150
BmeT110I	CYCGRG	2 cut(s)	57, 300
BmgBI	CACGTC	1 cut(s)	84
BmgT120I	GGNCC	1 cut(s)	150
BmrFI	CCNGG	3 cut(s)	43, 301, 302
BmrI	ACTGGG	2 cut(s)	269, 423
BmsI	GCATC	2 cut(s)	83, 559
BmuI	ACTGGG	2 cut(s)	269, 423
BplI	GAGNNNNNCTC	2 cut(s)	325, 357
BpuEI	CTTGAG	1 cut(s)	716
BpuMI	CCSGG	3 cut(s)	43, 301, 302
Bsa29I	ATCGAT	2 cut(s)	744, 849
BsaAI	YACGTR	1 cut(s)	619
BsaJI	CCNNGG	1 cut(s)	300
Bsc4I	CCNNNNNNNGG	1 cut(s)	147
Bse1I	ACTGG	2 cut(s)	275, 429
Bse3DI	GCAATG	1 cut(s)	221
BseCI	ATCGAT	2 cut(s)	744, 849
BseDI	CCNNGG	1 cut(s)	300
BseGI	GGATG	2 cut(s)	253, 811
BseLI	CCNNNNNNNGG	1 cut(s)	147
BseMI	GCAATG	1 cut(s)	221
BseMII	CTCAG	2 cut(s)	498, 719
BseNI	ACTGG	2 cut(s)	275, 429
BseXI	GCAGC	2 cut(s)	40, 825
BsgI	GTGCAG	1 cut(s)	659
Bsh1285I	CGRYCG	1 cut(s)	373
BshFI	GGCC	2 cut(s)	656, 832
BshVI	ATCGAT	2 cut(s)	744, 849
BsiEI	CGRYCG	1 cut(s)	373
BsiHKAI	GWGCWC	1 cut(s)	9
BsiHKCI	CYCGRG	2 cut(s)	57, 300
BsiSI	CCGG	2 cut(s)	43, 301
BslFI	GGGAC	1 cut(s)	317
BslI	CCNNNNNNNGG	1 cut(s)	147
BsmFI	GGGAC	1 cut(s)	317
BsnI	GGCC	2 cut(s)	656, 832
BsoBI	CYCGRG	2 cut(s)	57, 300
Bsp1286I	GDGCHC	1 cut(s)	9
Bsp143I	GATC	4 cut(s)	163, 741, 822, 850
BspACI	CCGC	4 cut(s)	109, 270, 313, 369
BspANI	GGCC	2 cut(s)	656, 832
BspCNI	CTCAG	2 cut(s)	497, 720
BspDI	ATCGAT	2 cut(s)	744, 849
BspHI	TCATGA	1 cut(s)	160
BsrDI	GCAATG	1 cut(s)	221
BsrI	ACTGG	2 cut(s)	275, 429
BssECI	CCNNGG	1 cut(s)	300
BssMI	GATC	4 cut(s)	163, 741, 822, 850
BssNAI	GTATAC	1 cut(s)	297
Bst1107I	GTATAC	1 cut(s)	297
BstBAI	YACGTR	1 cut(s)	619
BstDEI	CTNAG	3 cut(s)	467, 484, 728
BstF5I	GGATG	2 cut(s)	253, 811
BstKTI	GATC	4 cut(s)	166, 744, 825, 853
BstMBI	GATC	4 cut(s)	163, 741, 822, 850
BstMCI	CGRYCG	1 cut(s)	373
BstNSI	RCATGY	1 cut(s)	519
BstSCI	CCNGG	3 cut(s)	41, 299, 300
BstV1I	GCAGC	2 cut(s)	40, 825
BstZ17I	GTATAC	1 cut(s)	297
Bsu15I	ATCGAT	2 cut(s)	744, 849
BsuRI	GGCC	2 cut(s)	656, 832
BsuTUI	ATCGAT	2 cut(s)	744, 849
BtrI	CACGTC	1 cut(s)	84
BtsCI	GGATG	2 cut(s)	253, 811
BtsI	GCAGTG	1 cut(s)	233
BtsIMutI	CAGTG	4 cut(s)	233, 282, 602, 725
CciI	TCATGA	1 cut(s)	160
Cfr13I	GGNCC	1 cut(s)	150
Cfr9I	CCCGGG	1 cut(s)	300
ClaI	ATCGAT	2 cut(s)	744, 849
CseI	GACGC	1 cut(s)	745
Csp6I	GTAC	1 cut(s)	690
CviAII	CATG	6 cut(s)	161, 292, 447, 516, 562, 826
CviQI	GTAC	1 cut(s)	690
DdeI	CTNAG	3 cut(s)	467, 484, 728
DpnI	GATC	4 cut(s)	165, 743, 824, 852
DpnII	GATC	4 cut(s)	163, 741, 822, 850
DraI	TTTAAA	1 cut(s)	871
DraIII	CACNNNGTG	1 cut(s)	731
EaeI	YGGCCR	1 cut(s)	830
EciI	GGCGGA	1 cut(s)	124
Eco47I	GGWCC	1 cut(s)	150
Eco57I	CTGAAG	2 cut(s)	512, 779
Eco88I	CYCGRG	2 cut(s)	57, 300
FaeI	CATG	6 cut(s)	164, 295, 450, 519, 565, 829
FaqI	GGGAC	1 cut(s)	317
FatI	CATG	6 cut(s)	160, 291, 446, 515, 561, 825
FblI	GTMKAC	1 cut(s)	296
Fnu4HI	GCNGC	4 cut(s)	54, 270, 314, 814
FokI	GGATG	2 cut(s)	260, 818
Fsp4HI	GCNGC	4 cut(s)	54, 270, 314, 814
FspBI	CTAG	1 cut(s)	650
GluI	GCNGC	4 cut(s)	54, 270, 314, 814
HaeIII	GGCC	2 cut(s)	656, 832
HapII	CCGG	2 cut(s)	43, 301
HgaI	GACGC	1 cut(s)	745
Hin1II	CATG	6 cut(s)	164, 295, 450, 519, 565, 829
HindIII	AAGCTT	1 cut(s)	380
HinfI	GANTC	3 cut(s)	112, 670, 790
HpaII	CCGG	2 cut(s)	43, 301
HphI	GGTGA	1 cut(s)	107
Hpy166II	GTNNAC	1 cut(s)	297
Hpy188I	TCNGA	6 cut(s)	168, 345, 438, 531, 568, 798
Hpy188III	TCNNGA	4 cut(s)	161, 551, 767, 820
Hpy8I	GTNNAC	1 cut(s)	297
Hpy99I	CGWCG	1 cut(s)	85
HpyAV	CCTTC	2 cut(s)	20, 609
HpyCH4IV	ACGT	2 cut(s)	83, 618
HpyCH4V	TGCA	6 cut(s)	74, 87, 226, 515, 572, 676
HpyF3I	CTNAG	3 cut(s)	467, 484, 728
HpySE526I	ACGT	2 cut(s)	83, 618
Hsp92II	CATG	6 cut(s)	164, 295, 450, 519, 565, 829
Kzo9I	GATC	4 cut(s)	163, 741, 822, 850
LmnI	GCTCC	1 cut(s)	4
LpnPI	CCDG	9 cut(s)	56, 288, 314, 402, 442, 560, 564, 692, 872
Lsp1109I	GCAGC	2 cut(s)	40, 825
LweI	GCATC	2 cut(s)	83, 559
MaeI	CTAG	1 cut(s)	650
MaeII	ACGT	2 cut(s)	83, 618
MaeIII	GTNAC	4 cut(s)	29, 412, 456, 723
MalI	GATC	4 cut(s)	165, 743, 824, 852
MboI	GATC	4 cut(s)	163, 741, 822, 850
MboII	GAAGA	2 cut(s)	751, 785
MhlI	GDGCHC	1 cut(s)	9
MlsI	TGGCCA	1 cut(s)	832
MluCI	AATT	8 cut(s)	136, 186, 237, 260, 406, 440, 532, 866
MluNI	TGGCCA	1 cut(s)	832
MnlI	CCTC	7 cut(s)	94, 128, 327, 646, 691, 770, 868
Mox20I	TGGCCA	1 cut(s)	832
MscI	TGGCCA	1 cut(s)	832
MseI	TTAA	4 cut(s)	135, 546, 591, 870
MslI	CAYNNNNRTG	3 cut(s)	226, 327, 824
Msp20I	TGGCCA	1 cut(s)	832
MspI	CCGG	2 cut(s)	43, 301
MspR9I	CCNGG	3 cut(s)	43, 301, 302
NciI	CCSGG	3 cut(s)	43, 301, 302
NdeII	GATC	4 cut(s)	163, 741, 822, 850
NlaIII	CATG	6 cut(s)	164, 295, 450, 519, 565, 829
NmuCI	GTSAC	2 cut(s)	456, 723
NspI	RCATGY	1 cut(s)	519
PagI	TCATGA	1 cut(s)	160
PfeI	GAWTC	3 cut(s)	112, 670, 790
PflMI	CCANNNNNTGG	1 cut(s)	147
PkrI	GCNGC	4 cut(s)	55, 271, 315, 815
Ppu21I	YACGTR	1 cut(s)	619
PshBI	ATTAAT	1 cut(s)	546
PsiI	TTATAA	2 cut(s)	194, 327
PspPI	GGNCC	1 cut(s)	150
RsaI	GTAC	1 cut(s)	691
RsaNI	GTAC	1 cut(s)	690
RseI	CAYNNNNRTG	3 cut(s)	226, 327, 824
SaqAI	TTAA	4 cut(s)	135, 546, 591, 870
SatI	GCNGC	4 cut(s)	54, 270, 314, 814
Sau3AI	GATC	4 cut(s)	163, 741, 822, 850
Sau96I	GGNCC	1 cut(s)	150
ScrFI	CCNGG	3 cut(s)	43, 301, 302
SduI	GDGCHC	1 cut(s)	9
SfaNI	GCATC	2 cut(s)	83, 559
SinI	GGWCC	1 cut(s)	150
SmaI	CCCGGG	1 cut(s)	302
SmiMI	CAYNNNNRTG	3 cut(s)	226, 327, 824
SmlI	CTYRAG	1 cut(s)	695
SmoI	CTYRAG	1 cut(s)	695
Sse9I	AATT	8 cut(s)	136, 186, 237, 260, 406, 440, 532, 866
SsiI	CCGC	4 cut(s)	109, 270, 313, 369
SspI	AATATT	1 cut(s)	207
SspMI	CTAG	1 cut(s)	650
StyD4I	CCNGG	3 cut(s)	41, 299, 300
TaiI	ACGT	2 cut(s)	86, 621
TaqI	TCGA	3 cut(s)	744, 768, 849
TasI	AATT	8 cut(s)	136, 186, 237, 260, 406, 440, 532, 866
TauI	GCSGC	2 cut(s)	272, 316
TfiI	GAWTC	3 cut(s)	112, 670, 790
Tru1I	TTAA	4 cut(s)	135, 546, 591, 870
Tru9I	TTAA	4 cut(s)	135, 546, 591, 870
TscAI	CASTG	4 cut(s)	233, 282, 609, 732
TseFI	GTSAC	2 cut(s)	456, 723
TseI	GCWGC	2 cut(s)	53, 813
Tsp45I	GTSAC	2 cut(s)	456, 723
TspDTI	ATGAA	2 cut(s)	273, 634
TspGWI	ACGGA	1 cut(s)	142
TspMI	CCCGGG	1 cut(s)	300
TspRI	CASTG	4 cut(s)	233, 282, 609, 732
Van91I	CCANNNNNTGG	1 cut(s)	147
VpaK11BI	GGWCC	1 cut(s)	150
VspI	ATTAAT	1 cut(s)	546
XapI	RAATTY	5 cut(s)	186, 260, 440, 532, 866
XceI	RCATGY	1 cut(s)	519
XcmI	CCANNNNNNNNNTGG	2 cut(s)	282, 770
XmaI	CCCGGG	1 cut(s)	300
XmiI	GTMKAC	1 cut(s)	296
XspI	CTAG	1 cut(s)	650

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.