pycom1315g00050

Ethylbenzene dehydrogenase

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001315
Physical Location & Seq
Forward (+)
38589 .. 39372
784 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1315g00050.2

Sequence Viewer

Length: 186 bp
ATGAATCTTACATACCGGGTCCAGGCCGAGTTCGGACCGGGCCTTATCACTCTGGATGGTCATGCCGACGACTGGAAGGATATCGATGGGTTCGAGTTCTCCCTCCTCCCTGCTCTTGACCCAGATGCTGAGAACGAGTACAAAGGTGGAAAGATGACTGTTAAGGTACTCGTATTGTTACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.78

Weight (kDa)

4.3

Isoelectric Point (pI)

13.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 140, 168
AfiI CCNNNNNNNGG 2 cut(s) 22, 72
AjnI CCWGG 1 cut(s) 21
AlwNI CAGNNNCTG 1 cut(s) 128
AoxI GGCC 2 cut(s) 24, 40
AspS9I GGNCC 3 cut(s) 19, 35, 40
AsuC2I CCSGG 2 cut(s) 17, 39
AvaII GGWCC 2 cut(s) 19, 35
BccI CCATC 2 cut(s) 50, 80
BciT130I CCWGG 1 cut(s) 23
BcnI CCSGG 2 cut(s) 17, 39
Bme1390I CCNGG 3 cut(s) 17, 23, 39
Bme18I GGWCC 2 cut(s) 19, 35
BmgT120I GGNCC 3 cut(s) 19, 35, 40
BmiI GGNNCC 1 cut(s) 20
BmrFI CCNGG 3 cut(s) 17, 23, 39
BmsI GCATC 1 cut(s) 115
BpuMI CCSGG 2 cut(s) 17, 39
Bsa29I ATCGAT 1 cut(s) 84
Bsc4I CCNNNNNNNGG 2 cut(s) 22, 72
Bse1I ACTGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 23
BseCI ATCGAT 1 cut(s) 84
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 2 cut(s) 22, 72
BseMII CTCAG 1 cut(s) 120
BseNI ACTGG 1 cut(s) 77
BseRI GAGGAG 1 cut(s) 95
BshFI GGCC 2 cut(s) 26, 42
BshVI ATCGAT 1 cut(s) 84
BsiSI CCGG 2 cut(s) 16, 38
BslI CCNNNNNNNGG 2 cut(s) 22, 72
BsnI GGCC 2 cut(s) 26, 42
BspANI GGCC 2 cut(s) 26, 42
BspCNI CTCAG 1 cut(s) 121
BspDI ATCGAT 1 cut(s) 84
BspLI GGNNCC 1 cut(s) 20
BsrI ACTGG 1 cut(s) 77
Bst2UI CCWGG 1 cut(s) 23
Bst4CI ACNGT 2 cut(s) 160, 183
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 61
BstNI CCWGG 1 cut(s) 23
BstSCI CCNGG 3 cut(s) 15, 21, 37
Bsu15I ATCGAT 1 cut(s) 84
BsuRI GGCC 2 cut(s) 26, 42
BsuTUI ATCGAT 1 cut(s) 84
BtsCI GGATG 1 cut(s) 61
CaiI CAGNNNCTG 1 cut(s) 128
Cfr13I GGNCC 3 cut(s) 19, 35, 40
ClaI ATCGAT 1 cut(s) 84
CpoI CGGWCCG 1 cut(s) 35
Csp6I GTAC 2 cut(s) 139, 167
CspI CGGWCCG 1 cut(s) 35
CviAII CATG 1 cut(s) 62
CviJI RGCY 2 cut(s) 26, 42
CviKI_1 RGCY 2 cut(s) 26, 42
CviQI GTAC 2 cut(s) 139, 167
DdeI CTNAG 1 cut(s) 129
Eco32I GATATC 1 cut(s) 82
Eco47I GGWCC 2 cut(s) 19, 35
EcoRII CCWGG 1 cut(s) 21
EcoRV GATATC 1 cut(s) 82
FaeI CATG 1 cut(s) 65
FaiI YATR 2 cut(s) 13, 63
FatI CATG 1 cut(s) 61
FokI GGATG 1 cut(s) 68
HaeIII GGCC 2 cut(s) 26, 42
HapII CCGG 2 cut(s) 16, 38
Hin1II CATG 1 cut(s) 65
HinfI GANTC 1 cut(s) 4
HpaII CCGG 2 cut(s) 16, 38
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 2 cut(s) 53, 116
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 2 cut(s) 160, 183
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 65
LpnPI CCDG 8 cut(s) 8, 29, 35, 38, 51, 58, 123, 135
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 177
MnlI CCTC 2 cut(s) 113, 116
MseI TTAA 1 cut(s) 162
MspI CCGG 2 cut(s) 16, 38
MspR9I CCNGG 3 cut(s) 17, 23, 39
MvaI CCWGG 1 cut(s) 23
NciI CCSGG 2 cut(s) 17, 39
NlaIII CATG 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 20
NmeAIII GCCGAG 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PfeI GAWTC 1 cut(s) 4
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
PspN4I GGNNCC 1 cut(s) 20
PspPI GGNCC 3 cut(s) 19, 35, 40
PstNI CAGNNNCTG 1 cut(s) 128
RsaI GTAC 2 cut(s) 140, 168
RsaNI GTAC 2 cut(s) 139, 167
Rsr2I CGGWCCG 1 cut(s) 35
RsrII CGGWCCG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 162
Sau96I GGNCC 3 cut(s) 19, 35, 40
ScrFI CCNGG 3 cut(s) 17, 23, 39
SetI ASST 2 cut(s) 148, 168
SfaNI GCATC 1 cut(s) 115
SinI GGWCC 2 cut(s) 19, 35
StyD4I CCNGG 3 cut(s) 15, 21, 37
TaaI ACNGT 2 cut(s) 160, 183
TaqI TCGA 2 cut(s) 84, 93
TatI WGTACW 1 cut(s) 138
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 19, 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.