pycom1315g00060

Ethylbenzene dehydrogenase

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001315
Physical Location & Seq
Forward (+)
41913 .. 42220
308 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGAAATGGCGGTGACAGGTCTTTGTTTCAACAGGTTTGGTCATTTGGTTGATCTTTATGCATGGAATCCGCATTGTAGATACCTAGATGGAATTGGTTCTTCAGGTATTTTTGGGAGTTATTTATCCGACTACTACTTTAATCTATTTTTCTTAATGGGCATGAGAACCTACATAATGATAGAAAAAAGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.65

Weight (kDa)

6.01

Isoelectric Point (pI)

23.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 11, 71
AcuI CTGAAG 1 cut(s) 87
AgsI TTSAA 1 cut(s) 31
Asp700I GAANNNNTTC 1 cut(s) 97
AsuHPI GGTGA 1 cut(s) 25
BccI CCATC 1 cut(s) 83
BfaI CTAG 2 cut(s) 86, 196
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 2 cut(s) 11, 71
BssMI GATC 1 cut(s) 52
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
CviAII CATG 2 cut(s) 63, 163
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco57I CTGAAG 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 64
FaeI CATG 2 cut(s) 66, 166
FaiI YATR 4 cut(s) 60, 64, 164, 176
FatI CATG 2 cut(s) 62, 162
FspBI CTAG 2 cut(s) 86, 196
Hin1II CATG 2 cut(s) 66, 166
HinfI GANTC 1 cut(s) 67
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 62
Hsp92II CATG 2 cut(s) 66, 166
Kzo9I GATC 1 cut(s) 52
LpnPI CCDG 3 cut(s) 3, 19, 90
MaeI CTAG 2 cut(s) 86, 196
MaeIII GTNAC 1 cut(s) 13
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 93
MluCI AATT 1 cut(s) 93
MmeI TCCRAC 1 cut(s) 153
Mph1103I ATGCAT 1 cut(s) 64
MroXI GAANNNNTTC 1 cut(s) 97
MseI TTAA 2 cut(s) 141, 155
NdeII GATC 1 cut(s) 52
NlaIII CATG 2 cut(s) 66, 166
NmuCI GTSAC 1 cut(s) 13
NsiI ATGCAT 1 cut(s) 64
PdmI GAANNNNTTC 1 cut(s) 97
PfeI GAWTC 1 cut(s) 67
SaqAI TTAA 2 cut(s) 141, 155
Sau3AI GATC 1 cut(s) 52
SetI ASST 5 cut(s) 22, 38, 87, 109, 173
SgeI CNNG 6 cut(s) 30, 46, 75, 98, 117, 175
Sse9I AATT 1 cut(s) 93
SsiI CCGC 2 cut(s) 11, 71
SspMI CTAG 2 cut(s) 86, 196
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 2 cut(s) 141, 155
Tru9I TTAA 2 cut(s) 141, 155
TseFI GTSAC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 13
XmnI GAANNNNTTC 1 cut(s) 97
XspI CTAG 2 cut(s) 86, 196
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.