pycom13g01050

ZINC FINGER protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
694118 .. 694531
414 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g01050.1

Sequence Viewer

Length: 414 bp
ATGAACTCTCTTGCAAATGGCAACTCCTCGATTTTCGGAGGCGGGGGACTGGATCATAACAACTTTGGCGGGTTTAGTAGCGGCACTACTGCTACTAGAGTTAGTGCAATGGATCAACAGCATAATAACCCTAATTATGATGAGGCTAAGTTGCACCAAAATTTGAGTGTAAATTTTGGAGGGTCTGATAAACTGACCTTGGATTTTCTTGGTGTTGGAGGCATGGTAAGAAACATGAATGGTGGCCATGGATACTCACAGAGAGATCGATCAACAACAACAACATCATGGCATCAATATGATCAACTCCTTAGACCCAGAGTTGAAGTCAACGCAGGCAAGTCAACTCTTTGGAGGCACTACACTACAGTGAGCCTGCTAGATCGAGGAACTAAAATTACATTCATGGTATAG

Protein Analysis

138

Amino Acids

15.0

Weight (kDa)

9.15

Isoelectric Point (pI)

29.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 42, 69, 81
AclWI GGATC 2 cut(s) 60, 120
AcoI YGGCCR 1 cut(s) 244
AcsI RAATTY 2 cut(s) 160, 172
AgsI TTSAA 1 cut(s) 326
AleI CACNNNNGTG 1 cut(s) 368
AlwI GGATC 2 cut(s) 60, 120
AoxI GGCC 1 cut(s) 244
ApoI RAATTY 2 cut(s) 160, 172
BalI TGGCCA 1 cut(s) 246
BciVI GTATCC 1 cut(s) 245
BclI TGATCA 1 cut(s) 301
BfaI CTAG 2 cut(s) 96, 380
BfmI CTRYAG 1 cut(s) 366
BfuI GTATCC 1 cut(s) 245
BisI GCNGC 1 cut(s) 82
BlsI GCNGC 1 cut(s) 83
BmsI GCATC 1 cut(s) 301
Bsa29I ATCGAT 1 cut(s) 268
BsaJI CCNNGG 2 cut(s) 198, 247
BsaXI ACNNNNNCTCC 2 cut(s) 210, 240
Bse1I ACTGG 1 cut(s) 54
Bse3DI GCAATG 1 cut(s) 114
BseCI ATCGAT 1 cut(s) 268
BseDI CCNNGG 2 cut(s) 198, 247
BseMI GCAATG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 16
BshFI GGCC 1 cut(s) 246
BshVI ATCGAT 1 cut(s) 268
BslFI GGGAC 1 cut(s) 60
BsmFI GGGAC 1 cut(s) 60
BsnI GGCC 1 cut(s) 246
Bsp143I GATC 6 cut(s) 52, 112, 265, 269, 301, 382
Bsp19I CCATGG 1 cut(s) 247
BspACI CCGC 3 cut(s) 42, 69, 81
BspANI GGCC 1 cut(s) 246
BspDI ATCGAT 1 cut(s) 268
BspPI GGATC 2 cut(s) 60, 120
BsrDI GCAATG 1 cut(s) 114
BsrI ACTGG 1 cut(s) 54
BssECI CCNNGG 2 cut(s) 198, 247
BssMI GATC 6 cut(s) 52, 112, 265, 269, 301, 382
BssT1I CCWWGG 2 cut(s) 198, 247
Bst4CI ACNGT 1 cut(s) 370
BstC8I GCNNGC 2 cut(s) 337, 377
BstDEI CTNAG 2 cut(s) 147, 311
BstDSI CCRYGG 1 cut(s) 247
BstKTI GATC 6 cut(s) 55, 115, 268, 272, 304, 385
BstMBI GATC 6 cut(s) 52, 112, 265, 269, 301, 382
BstSFI CTRYAG 1 cut(s) 366
Bsu15I ATCGAT 1 cut(s) 268
BsuI GTATCC 1 cut(s) 245
BsuRI GGCC 1 cut(s) 246
BsuTUI ATCGAT 1 cut(s) 268
BtgI CCRYGG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 375
Cac8I GCNNGC 2 cut(s) 337, 377
ClaI ATCGAT 1 cut(s) 268
CviAII CATG 5 cut(s) 223, 235, 248, 288, 406
CviJI RGCY 3 cut(s) 146, 246, 375
CviKI_1 RGCY 3 cut(s) 146, 246, 375
DdeI CTNAG 2 cut(s) 147, 311
DpnI GATC 6 cut(s) 54, 114, 267, 271, 303, 384
DpnII GATC 6 cut(s) 52, 112, 265, 269, 301, 382
EaeI YGGCCR 1 cut(s) 244
Eco130I CCWWGG 2 cut(s) 198, 247
EcoT14I CCWWGG 2 cut(s) 198, 247
ErhI CCWWGG 2 cut(s) 198, 247
FaeI CATG 5 cut(s) 226, 238, 251, 291, 409
FaqI GGGAC 1 cut(s) 60
FatI CATG 5 cut(s) 222, 234, 247, 287, 405
FauI CCCGC 2 cut(s) 35, 62
FbaI TGATCA 1 cut(s) 301
Fnu4HI GCNGC 1 cut(s) 82
Fsp4HI GCNGC 1 cut(s) 82
FspBI CTAG 2 cut(s) 96, 380
GluI GCNGC 1 cut(s) 82
HaeIII GGCC 1 cut(s) 246
Hin1II CATG 5 cut(s) 226, 238, 251, 291, 409
HincII GTYRAC 2 cut(s) 331, 345
HindII GTYRAC 2 cut(s) 331, 345
Hpy166II GTNNAC 2 cut(s) 331, 345
Hpy188I TCNGA 2 cut(s) 38, 187
Hpy8I GTNNAC 2 cut(s) 331, 345
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 3 cut(s) 14, 107, 154
HpyF3I CTNAG 2 cut(s) 147, 311
Hsp92II CATG 5 cut(s) 226, 238, 251, 291, 409
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 6 cut(s) 52, 112, 265, 269, 301, 382
LpnPI CCDG 4 cut(s) 35, 321, 331, 389
LweI GCATC 1 cut(s) 301
MaeI CTAG 2 cut(s) 96, 380
MalI GATC 6 cut(s) 54, 114, 267, 271, 303, 384
MboI GATC 6 cut(s) 52, 112, 265, 269, 301, 382
MlsI TGGCCA 1 cut(s) 246
MluCI AATT 4 cut(s) 133, 160, 172, 396
MluNI TGGCCA 1 cut(s) 246
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 7 cut(s) 32, 37, 136, 173, 212, 348, 380
Mox20I TGGCCA 1 cut(s) 246
MscI TGGCCA 1 cut(s) 246
MslI CAYNNNNRTG 2 cut(s) 297, 368
Msp20I TGGCCA 1 cut(s) 246
NcoI CCATGG 1 cut(s) 247
NdeII GATC 6 cut(s) 52, 112, 265, 269, 301, 382
NlaIII CATG 5 cut(s) 226, 238, 251, 291, 409
OliI CACNNNNGTG 1 cut(s) 368
PkrI GCNGC 1 cut(s) 83
PsrI GAACNNNNNNTAC 2 cut(s) 382, 414
RseI CAYNNNNRTG 2 cut(s) 297, 368
SatI GCNGC 1 cut(s) 82
Sau3AI GATC 6 cut(s) 52, 112, 265, 269, 301, 382
SetI ASST 1 cut(s) 200
SfaNI GCATC 1 cut(s) 301
SfcI CTRYAG 1 cut(s) 366
SmiMI CAYNNNNRTG 2 cut(s) 297, 368
Sse9I AATT 4 cut(s) 133, 160, 172, 396
SsiI CCGC 3 cut(s) 42, 69, 81
SspMI CTAG 2 cut(s) 96, 380
StyI CCWWGG 2 cut(s) 198, 247
TaaI ACNGT 1 cut(s) 370
TaqI TCGA 3 cut(s) 29, 268, 385
TasI AATT 4 cut(s) 133, 160, 172, 396
TauI GCSGC 1 cut(s) 84
TscAI CASTG 1 cut(s) 375
TspDTI ATGAA 3 cut(s) 17, 251, 394
TspRI CASTG 1 cut(s) 375
XapI RAATTY 2 cut(s) 160, 172
XspI CTAG 2 cut(s) 96, 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.