pycom16g00930

ZINC FINGER protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
555945 .. 556208
264 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g00930.1

Sequence Viewer

Length: 264 bp
ATGGACCAACAGCATAATAACCCTAATTATGATGAGGCCAAGATGCACCAAAATTTGGGTGTGAATTTTGGAGGATCTGATAAATTGACCTTGGATTTTCTTGGTGTTGGAGGGATGGTAAGAAATATGAGTGGTGGCCATGGATACTCACAGAGAGATAATCTACAACAACAACATCATGGCATCAATATGATCAGCTCTTTGGACCCAGAGTTGGAGTCAGCACAGGCAAGTCAACCCTTTGGAGGCACTACACTACAATGA

Protein Analysis

88

Amino Acids

9.5

Weight (kDa)

5.24

Isoelectric Point (pI)

56.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 55
AclWI GGATC 1 cut(s) 82
AcoI YGGCCR 1 cut(s) 136
AcsI RAATTY 2 cut(s) 52, 64
AfiI CCNNNNNNNGG 3 cut(s) 55, 214, 245
AluBI AGCT 1 cut(s) 198
AluI AGCT 1 cut(s) 198
AlwI GGATC 1 cut(s) 82
AoxI GGCC 2 cut(s) 36, 136
ApoI RAATTY 2 cut(s) 52, 64
AspS9I GGNCC 2 cut(s) 4, 205
AvaII GGWCC 2 cut(s) 4, 205
BalI TGGCCA 1 cut(s) 138
BccI CCATC 1 cut(s) 109
BciVI GTATCC 1 cut(s) 137
BclI TGATCA 1 cut(s) 192
BfuI GTATCC 1 cut(s) 137
Bme18I GGWCC 2 cut(s) 4, 205
BmgT120I GGNCC 2 cut(s) 4, 205
BmiI GGNNCC 1 cut(s) 207
BmsI GCATC 2 cut(s) 33, 192
BsaJI CCNNGG 2 cut(s) 90, 139
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bsc4I CCNNNNNNNGG 3 cut(s) 55, 214, 245
BseDI CCNNGG 2 cut(s) 90, 139
BseGI GGATG 1 cut(s) 120
BseLI CCNNNNNNNGG 3 cut(s) 55, 214, 245
BshFI GGCC 2 cut(s) 38, 138
BslI CCNNNNNNNGG 3 cut(s) 55, 214, 245
BsnI GGCC 2 cut(s) 38, 138
Bsp143I GATC 2 cut(s) 74, 192
Bsp19I CCATGG 1 cut(s) 139
BspANI GGCC 2 cut(s) 38, 138
BspLI GGNNCC 1 cut(s) 207
BspPI GGATC 1 cut(s) 82
BssECI CCNNGG 2 cut(s) 90, 139
BssMI GATC 2 cut(s) 74, 192
BssT1I CCWWGG 2 cut(s) 90, 139
BstDSI CCRYGG 1 cut(s) 139
BstF5I GGATG 1 cut(s) 120
BstKTI GATC 2 cut(s) 77, 195
BstMBI GATC 2 cut(s) 74, 192
BstX2I RGATCY 1 cut(s) 74
BstYI RGATCY 1 cut(s) 74
BsuI GTATCC 1 cut(s) 137
BsuRI GGCC 2 cut(s) 38, 138
BtgI CCRYGG 1 cut(s) 139
BtsCI GGATG 1 cut(s) 120
Cfr13I GGNCC 2 cut(s) 4, 205
CviAII CATG 2 cut(s) 140, 179
CviJI RGCY 3 cut(s) 38, 138, 198
CviKI_1 RGCY 3 cut(s) 38, 138, 198
DpnI GATC 2 cut(s) 76, 194
DpnII GATC 2 cut(s) 74, 192
EaeI YGGCCR 1 cut(s) 136
Eco130I CCWWGG 2 cut(s) 90, 139
Eco47I GGWCC 2 cut(s) 4, 205
EcoT14I CCWWGG 2 cut(s) 90, 139
ErhI CCWWGG 2 cut(s) 90, 139
FaeI CATG 2 cut(s) 143, 182
FaiI YATR 6 cut(s) 15, 30, 128, 141, 180, 191
FatI CATG 2 cut(s) 139, 178
FbaI TGATCA 1 cut(s) 192
FokI GGATG 1 cut(s) 127
HaeIII GGCC 2 cut(s) 38, 138
Hin1II CATG 2 cut(s) 143, 182
HincII GTYRAC 1 cut(s) 236
HindII GTYRAC 1 cut(s) 236
HinfI GANTC 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 236
Hpy188I TCNGA 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 236
HpyCH4V TGCA 1 cut(s) 46
Hsp92II CATG 2 cut(s) 143, 182
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 2 cut(s) 74, 192
LpnPI CCDG 2 cut(s) 212, 222
LweI GCATC 2 cut(s) 33, 192
MalI GATC 2 cut(s) 76, 194
MboI GATC 2 cut(s) 74, 192
MflI RGATCY 1 cut(s) 74
MlsI TGGCCA 1 cut(s) 138
MluCI AATT 4 cut(s) 25, 52, 64, 83
MluNI TGGCCA 1 cut(s) 138
MlyI GAGTC 1 cut(s) 227
MmeI TCCRAC 2 cut(s) 88, 195
MnlI CCTC 4 cut(s) 28, 65, 104, 239
Mox20I TGGCCA 1 cut(s) 138
MscI TGGCCA 1 cut(s) 138
MslI CAYNNNNRTG 2 cut(s) 188, 259
Msp20I TGGCCA 1 cut(s) 138
NcoI CCATGG 1 cut(s) 139
NdeII GATC 2 cut(s) 74, 192
NlaIII CATG 2 cut(s) 143, 182
NlaIV GGNNCC 1 cut(s) 207
PflMI CCANNNNNTGG 1 cut(s) 55
PleI GAGTC 1 cut(s) 226
PpsI GAGTC 1 cut(s) 226
PspN4I GGNNCC 1 cut(s) 207
PspPI GGNCC 2 cut(s) 4, 205
PsuI RGATCY 1 cut(s) 74
RseI CAYNNNNRTG 2 cut(s) 188, 259
Sau3AI GATC 2 cut(s) 74, 192
Sau96I GGNCC 2 cut(s) 4, 205
SchI GAGTC 1 cut(s) 227
SetI ASST 2 cut(s) 92, 200
SfaNI GCATC 2 cut(s) 33, 192
SgeI CNNG 8 cut(s) 52, 103, 113, 152, 191, 221, 239, 243
SinI GGWCC 2 cut(s) 4, 205
SmiMI CAYNNNNRTG 2 cut(s) 188, 259
Sse9I AATT 4 cut(s) 25, 52, 64, 83
StyI CCWWGG 2 cut(s) 90, 139
TasI AATT 4 cut(s) 25, 52, 64, 83
Van91I CCANNNNNTGG 1 cut(s) 55
VpaK11BI GGWCC 2 cut(s) 4, 205
XapI RAATTY 2 cut(s) 52, 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.